Incidental Mutation 'R3404:Bdkrb2'
ID259294
Institutional Source Beutler Lab
Gene Symbol Bdkrb2
Ensembl Gene ENSMUSG00000021070
Gene Namebradykinin receptor, beta 2
Synonymskinin B2, B2R, B(2), B2, BK2R
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location105563226-105595237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105592496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 332 (V332A)
Ref Sequence ENSEMBL: ENSMUSP00000001652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001652
AA Change: V332A

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001652
Gene: ENSMUSG00000021070
AA Change: V332A

DomainStartEndE-ValueType
Pfam:7tm_1 75 333 8.8e-56 PFAM
Meta Mutation Damage Score 0.3737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for bradykinin. The 9 aa bradykinin peptide elicits many responses including vasodilation, edema, smooth muscle spasm and pain fiber stimulation. This receptor associates with G proteins that stimulate a phosphatidylinositol-calcium second messenger system. Alternate start codons result in two isoforms of the protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are indistinguishable from normal littermates, but bradykinin response is eliminated in ileum, uterus, and cervical ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Bdkrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Bdkrb2 APN 12 105588303 splice site probably benign
IGL00703:Bdkrb2 APN 12 105592355 missense probably benign 0.04
R0465:Bdkrb2 UTSW 12 105591859 missense possibly damaging 0.89
R1082:Bdkrb2 UTSW 12 105592592 missense probably benign 0.00
R1171:Bdkrb2 UTSW 12 105592157 missense probably benign
R1589:Bdkrb2 UTSW 12 105591859 missense possibly damaging 0.94
R2265:Bdkrb2 UTSW 12 105592225 missense probably benign 0.00
R3406:Bdkrb2 UTSW 12 105592496 missense possibly damaging 0.90
R3857:Bdkrb2 UTSW 12 105592439 missense probably benign 0.08
R4761:Bdkrb2 UTSW 12 105588278 missense probably benign 0.00
R4833:Bdkrb2 UTSW 12 105591658 missense probably benign 0.10
R6916:Bdkrb2 UTSW 12 105591779 missense probably damaging 0.96
R7358:Bdkrb2 UTSW 12 105592541 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGTTCAAGGAGGTCCAGACG -3'
(R):5'- ACACACTTGGCAGTAGTCCTG -3'

Sequencing Primer
(F):5'- AAGGCCACCGTGCTAGTG -3'
(R):5'- CAGTAGTCCTGCCTGGTGG -3'
Posted On2015-01-23