Incidental Mutation 'R3404:Snx31'
ID259300
Institutional Source Beutler Lab
Gene Symbol Snx31
Ensembl Gene ENSMUSG00000013611
Gene Namesorting nexin 31
Synonyms4631426E05Rik
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3404 (G1)
Quality Score197
Status Validated
Chromosome15
Chromosomal Location36504062-36555573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36525653 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 300 (C300Y)
Ref Sequence ENSEMBL: ENSMUSP00000124063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013755] [ENSMUST00000161202]
Predicted Effect probably benign
Transcript: ENSMUST00000013755
AA Change: C300Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000013755
Gene: ENSMUSG00000013611
AA Change: C300Y

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161202
AA Change: C300Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124063
Gene: ENSMUSG00000013611
AA Change: C300Y

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Meta Mutation Damage Score 0.1353 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Snx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Snx31 APN 15 36545616 critical splice acceptor site probably null
IGL01627:Snx31 APN 15 36517672 missense probably damaging 1.00
IGL02514:Snx31 APN 15 36525582 missense probably damaging 1.00
IGL03069:Snx31 APN 15 36525603 nonsense probably null
IGL03182:Snx31 APN 15 36525687 missense probably benign 0.00
R0755:Snx31 UTSW 15 36534430 missense probably damaging 0.99
R1005:Snx31 UTSW 15 36517691 splice site probably benign
R1463:Snx31 UTSW 15 36539298 missense probably null 1.00
R1513:Snx31 UTSW 15 36545600 missense probably damaging 0.99
R2030:Snx31 UTSW 15 36525702 missense probably benign 0.31
R3720:Snx31 UTSW 15 36523558 critical splice acceptor site probably null
R4152:Snx31 UTSW 15 36525639 missense probably benign
R4474:Snx31 UTSW 15 36546111 intron probably benign
R4729:Snx31 UTSW 15 36523552 missense possibly damaging 0.92
R4998:Snx31 UTSW 15 36539367 missense probably damaging 0.96
R5010:Snx31 UTSW 15 36555324 missense probably damaging 1.00
R5375:Snx31 UTSW 15 36525584 missense probably damaging 0.99
R5893:Snx31 UTSW 15 36523455 missense probably damaging 0.98
R5970:Snx31 UTSW 15 36523488 nonsense probably null
R6211:Snx31 UTSW 15 36546885 missense probably damaging 0.98
R7198:Snx31 UTSW 15 36555310 missense probably benign 0.04
R7293:Snx31 UTSW 15 36523450 missense probably damaging 0.97
R7329:Snx31 UTSW 15 36555476 missense probably benign 0.00
R7741:Snx31 UTSW 15 36523441 critical splice donor site probably null
R8057:Snx31 UTSW 15 36523460 missense probably damaging 0.98
R8791:Snx31 UTSW 15 36537532 missense probably benign 0.01
R8806:Snx31 UTSW 15 36537552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGACATCCAAAGTGAC -3'
(R):5'- CCCGCTGTGAGCTCCATAAATG -3'

Sequencing Primer
(F):5'- AACTTGCTCATAGGCTAGGC -3'
(R):5'- GCTGTGAGCTCCATAAATGTGAAAAC -3'
Posted On2015-01-23