Incidental Mutation 'R3404:Senp7'
ID259304
Institutional Source Beutler Lab
Gene Symbol Senp7
Ensembl Gene ENSMUSG00000052917
Gene NameSUMO1/sentrin specific peptidase 7
Synonyms
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56048338-56190012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56188277 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1007 (W1007R)
Ref Sequence ENSEMBL: ENSMUSP00000086779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089360] [ENSMUST00000089362]
Predicted Effect probably damaging
Transcript: ENSMUST00000089360
AA Change: W980R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086776
Gene: ENSMUSG00000052917
AA Change: W980R

DomainStartEndE-ValueType
low complexity region 165 181 N/A INTRINSIC
low complexity region 352 376 N/A INTRINSIC
low complexity region 386 395 N/A INTRINSIC
low complexity region 639 646 N/A INTRINSIC
Pfam:Peptidase_C48 734 999 7.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089362
AA Change: W1007R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086779
Gene: ENSMUSG00000052917
AA Change: W1007R

DomainStartEndE-ValueType
low complexity region 192 208 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 666 673 N/A INTRINSIC
Pfam:Peptidase_C48 761 1026 8.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202272
Meta Mutation Damage Score 0.8761 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a SUMO deconjugating enzyme of the Sentrin/SUMO-specific protease (SENP) family. The encoded protein is a protease that exhibits deSUMOylating activity towards proteins involved in chromatin remodeling and promotes chromatin relaxation for DNA repair or transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Senp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Senp7 APN 16 56082377 missense probably damaging 0.96
IGL01610:Senp7 APN 16 56175823 missense possibly damaging 0.94
IGL01627:Senp7 APN 16 56171856 missense probably damaging 1.00
IGL02748:Senp7 APN 16 56186094 missense probably damaging 1.00
IGL03031:Senp7 APN 16 56175886 missense probably damaging 1.00
IGL03083:Senp7 APN 16 56171865 missense probably benign 0.28
R0034:Senp7 UTSW 16 56153570 missense possibly damaging 0.63
R0200:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0242:Senp7 UTSW 16 56179521 missense probably damaging 1.00
R0547:Senp7 UTSW 16 56175826 missense probably damaging 1.00
R0608:Senp7 UTSW 16 56123873 missense possibly damaging 0.66
R1595:Senp7 UTSW 16 56184768 missense probably damaging 1.00
R1737:Senp7 UTSW 16 56123799 missense probably damaging 1.00
R1837:Senp7 UTSW 16 56158516 missense probably benign 0.01
R1945:Senp7 UTSW 16 56123946 missense probably damaging 0.98
R2143:Senp7 UTSW 16 56169806 missense probably benign
R2275:Senp7 UTSW 16 56184783 missense probably damaging 1.00
R2508:Senp7 UTSW 16 56151362 missense probably benign 0.28
R3405:Senp7 UTSW 16 56188277 missense probably damaging 1.00
R3717:Senp7 UTSW 16 56179057 splice site probably benign
R3885:Senp7 UTSW 16 56186079 missense probably damaging 1.00
R4159:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4160:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4161:Senp7 UTSW 16 56153469 missense possibly damaging 0.86
R4512:Senp7 UTSW 16 56165883 missense probably damaging 1.00
R5291:Senp7 UTSW 16 56186179 nonsense probably null
R5315:Senp7 UTSW 16 56180526 missense probably benign 0.26
R5390:Senp7 UTSW 16 56169916 missense probably benign
R5424:Senp7 UTSW 16 56186108 missense possibly damaging 0.82
R5643:Senp7 UTSW 16 56184149 splice site silent
R5644:Senp7 UTSW 16 56184149 splice site silent
R5645:Senp7 UTSW 16 56173208 missense possibly damaging 0.80
R5799:Senp7 UTSW 16 56139105 splice site probably null
R5860:Senp7 UTSW 16 56155359 missense possibly damaging 0.49
R5954:Senp7 UTSW 16 56169871 missense probably benign 0.04
R6164:Senp7 UTSW 16 56169754 missense probably damaging 1.00
R6280:Senp7 UTSW 16 56162375 missense possibly damaging 0.62
R6647:Senp7 UTSW 16 56173255 missense probably damaging 1.00
R6652:Senp7 UTSW 16 56123894 missense probably benign 0.08
R7310:Senp7 UTSW 16 56186082 missense probably benign 0.18
R7460:Senp7 UTSW 16 56173182 missense possibly damaging 0.65
R7480:Senp7 UTSW 16 56155226 missense possibly damaging 0.80
R7609:Senp7 UTSW 16 56111637 missense probably benign 0.06
R7760:Senp7 UTSW 16 56139079 missense probably benign
R8171:Senp7 UTSW 16 56111726 missense probably damaging 1.00
R8290:Senp7 UTSW 16 56153637 nonsense probably null
R8305:Senp7 UTSW 16 56155240 missense probably damaging 1.00
R8353:Senp7 UTSW 16 56188328 missense probably damaging 1.00
R8394:Senp7 UTSW 16 56169827 missense possibly damaging 0.81
R8428:Senp7 UTSW 16 56179028 missense probably damaging 1.00
R8453:Senp7 UTSW 16 56188328 missense probably damaging 1.00
R8554:Senp7 UTSW 16 56158610 missense probably benign 0.01
R8669:Senp7 UTSW 16 56165952 missense probably damaging 0.97
U24488:Senp7 UTSW 16 56184819 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACCTAGTCGAAACTGAAGG -3'
(R):5'- TGTAAGCTGACACAGATGCTGG -3'

Sequencing Primer
(F):5'- CCTAGTCGAAACTGAAGGCTTACTG -3'
(R):5'- CTGGTAAGCGGCTTTCTAGGAAAC -3'
Posted On2015-01-23