Incidental Mutation 'R3404:Hspa13'
ID259305
Institutional Source Beutler Lab
Gene Symbol Hspa13
Ensembl Gene ENSMUSG00000032932
Gene Nameheat shock protein 70 family, member 13
Synonyms1600002I10Rik, Stch, 60kDa, B230217N24Rik
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.759) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location75745431-75767104 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 75758026 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 391 (E391*)
Ref Sequence ENSEMBL: ENSMUSP00000048817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046283] [ENSMUST00000114244] [ENSMUST00000232633]
Predicted Effect probably null
Transcript: ENSMUST00000046283
AA Change: E391*
SMART Domains Protein: ENSMUSP00000048817
Gene: ENSMUSG00000032932
AA Change: E391*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 347 3.4e-79 PFAM
Pfam:HSP70 349 460 5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114244
SMART Domains Protein: ENSMUSP00000109882
Gene: ENSMUSG00000032932

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 260 1.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137806
Predicted Effect probably benign
Transcript: ENSMUST00000232633
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Fezf1 A T 6: 23,247,284 V264D probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Hspa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Hspa13 APN 16 75757992 missense possibly damaging 0.86
IGL03350:Hspa13 APN 16 75757829 missense probably damaging 1.00
R0329:Hspa13 UTSW 16 75765130 missense probably damaging 1.00
R1018:Hspa13 UTSW 16 75761276 missense possibly damaging 0.56
R1029:Hspa13 UTSW 16 75765237 missense probably damaging 1.00
R2043:Hspa13 UTSW 16 75758268 missense probably benign 0.01
R3766:Hspa13 UTSW 16 75765086 missense probably benign 0.00
R4596:Hspa13 UTSW 16 75758226 missense probably benign 0.01
R4610:Hspa13 UTSW 16 75761302 missense probably benign 0.02
R4839:Hspa13 UTSW 16 75765281 missense probably damaging 1.00
R5621:Hspa13 UTSW 16 75766763 utr 5 prime probably benign
R5782:Hspa13 UTSW 16 75758097 missense probably damaging 1.00
R6428:Hspa13 UTSW 16 75757986 missense probably damaging 1.00
R6597:Hspa13 UTSW 16 75765197 missense probably damaging 1.00
R6746:Hspa13 UTSW 16 75765037 missense possibly damaging 0.89
R6903:Hspa13 UTSW 16 75757984 missense probably damaging 1.00
Z1088:Hspa13 UTSW 16 75758185 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCACTAACTTGGAGAGGCC -3'
(R):5'- TGACTCTGAACTGCCAAAAGAC -3'

Sequencing Primer
(F):5'- GCCAGGAGCCTCCATCAATC -3'
(R):5'- CCAGCTCACCCCAGGAGATG -3'
Posted On2015-01-23