Incidental Mutation 'R3405:Ncf2'
ID259314
Institutional Source Beutler Lab
Gene Symbol Ncf2
Ensembl Gene ENSMUSG00000026480
Gene Nameneutrophil cytosolic factor 2
SynonymsNOXA2, p67phox, Ncf-2, NADPH oxidase subunit (67kDa)
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152800194-152836991 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 152825947 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000186568] [ENSMUST00000190323]
Predicted Effect probably benign
Transcript: ENSMUST00000027754
SMART Domains Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186568
SMART Domains Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189135
Predicted Effect probably benign
Transcript: ENSMUST00000190323
SMART Domains Protein: ENSMUSP00000139774
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
Pfam:TPR_1 1 26 5.8e-4 PFAM
low complexity region 54 69 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Ncf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Ncf2 APN 1 152808174 missense possibly damaging 0.49
IGL00952:Ncf2 APN 1 152836106 missense probably benign 0.19
IGL01504:Ncf2 APN 1 152833329 missense probably benign 0.00
IGL01693:Ncf2 APN 1 152824323 missense probably benign 0.00
IGL02005:Ncf2 APN 1 152817052 missense possibly damaging 0.73
IGL02041:Ncf2 APN 1 152836120 utr 3 prime probably benign
IGL02327:Ncf2 APN 1 152816993 missense possibly damaging 0.49
IGL02366:Ncf2 APN 1 152835073 missense probably benign
IGL02627:Ncf2 APN 1 152811008 splice site probably benign
R0560:Ncf2 UTSW 1 152821522 missense probably damaging 1.00
R1136:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R1640:Ncf2 UTSW 1 152808033 start codon destroyed probably null 1.00
R1673:Ncf2 UTSW 1 152830479 missense probably benign 0.13
R1836:Ncf2 UTSW 1 152808071 missense probably damaging 1.00
R1873:Ncf2 UTSW 1 152825910 missense probably benign 0.00
R1940:Ncf2 UTSW 1 152834064 splice site probably benign
R1967:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R3406:Ncf2 UTSW 1 152825947 unclassified probably benign
R4501:Ncf2 UTSW 1 152835033 missense probably benign 0.00
R4503:Ncf2 UTSW 1 152833778 missense probably benign 0.20
R4563:Ncf2 UTSW 1 152808225 intron probably benign
R5841:Ncf2 UTSW 1 152821518 splice site silent
R6336:Ncf2 UTSW 1 152834070 missense probably damaging 1.00
R6385:Ncf2 UTSW 1 152830422 missense probably benign 0.00
R6522:Ncf2 UTSW 1 152827463 critical splice donor site probably null
R6811:Ncf2 UTSW 1 152836040 missense probably benign 0.00
R7048:Ncf2 UTSW 1 152808170 missense probably benign
X0066:Ncf2 UTSW 1 152810979 start codon destroyed probably null 0.27
Z1177:Ncf2 UTSW 1 152825942 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGAGGTGCCTTACTTCCCAC -3'
(R):5'- TGGATCTCTTAGGACCACCG -3'

Sequencing Primer
(F):5'- AGCTACCTGAGTGACAATGGCTTC -3'
(R):5'- TCTTAGGACCACCGGCAGAG -3'
Posted On2015-01-23