Incidental Mutation 'R3405:Exo1'
ID259316
Institutional Source Beutler Lab
Gene Symbol Exo1
Ensembl Gene ENSMUSG00000039748
Gene Nameexonuclease 1
Synonyms5730442G03Rik, Msa
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175880581-175913489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175905970 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 787 (K787E)
Ref Sequence ENSEMBL: ENSMUSP00000039376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039725
AA Change: K787E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039376
Gene: ENSMUSG00000039748
AA Change: K787E

DomainStartEndE-ValueType
XPGN 1 99 6.24e-38 SMART
XPGI 138 208 4.56e-31 SMART
HhH2 212 245 2.28e-8 SMART
Blast:XPGI 252 288 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193610
Predicted Effect unknown
Transcript: ENSMUST00000194636
AA Change: K121E
Predicted Effect unknown
Transcript: ENSMUST00000194816
AA Change: K80E
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced life span, lymphoma development, and male/female sterilty due to defective meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Exo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Exo1 APN 1 175896237 missense probably benign 0.00
IGL01116:Exo1 APN 1 175901397 missense possibly damaging 0.76
IGL01766:Exo1 APN 1 175892021 missense possibly damaging 0.67
IGL02117:Exo1 APN 1 175893743 missense possibly damaging 0.60
IGL02979:Exo1 APN 1 175899407 missense probably damaging 1.00
IGL03026:Exo1 APN 1 175908437 makesense probably null
IGL03109:Exo1 APN 1 175899560 missense probably damaging 1.00
IGL03208:Exo1 APN 1 175896245 missense probably benign 0.01
IGL03342:Exo1 APN 1 175892127 missense probably benign 0.09
IGL03147:Exo1 UTSW 1 175888788 missense probably damaging 1.00
R0194:Exo1 UTSW 1 175892030 missense probably damaging 1.00
R0427:Exo1 UTSW 1 175905953 missense probably damaging 0.96
R0520:Exo1 UTSW 1 175899465 missense probably benign 0.00
R1382:Exo1 UTSW 1 175893796 missense probably damaging 0.98
R1618:Exo1 UTSW 1 175901386 missense probably benign 0.00
R1666:Exo1 UTSW 1 175908486 missense possibly damaging 0.81
R2007:Exo1 UTSW 1 175908530 missense probably damaging 1.00
R2177:Exo1 UTSW 1 175882890 splice site probably null
R2224:Exo1 UTSW 1 175886688 critical splice acceptor site probably null
R2305:Exo1 UTSW 1 175888761 missense probably damaging 1.00
R2509:Exo1 UTSW 1 175905833 missense probably damaging 1.00
R3406:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3711:Exo1 UTSW 1 175893829 missense probably benign
R3767:Exo1 UTSW 1 175886746 missense probably damaging 1.00
R3787:Exo1 UTSW 1 175899469 missense probably benign
R3853:Exo1 UTSW 1 175892988 missense probably benign 0.01
R5304:Exo1 UTSW 1 175892976 missense probably damaging 1.00
R5625:Exo1 UTSW 1 175893814 missense possibly damaging 0.51
R5869:Exo1 UTSW 1 175901283 missense possibly damaging 0.59
R7013:Exo1 UTSW 1 175893772 missense probably damaging 1.00
R7238:Exo1 UTSW 1 175888847 missense probably damaging 1.00
R7514:Exo1 UTSW 1 175906666 splice site probably null
R7522:Exo1 UTSW 1 175901304 missense probably benign 0.08
R7895:Exo1 UTSW 1 175900996 missense probably benign 0.06
R7978:Exo1 UTSW 1 175900996 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCTTCAGGTTCCTGGGCTC -3'
(R):5'- TGTTAGGTCGCCAGTCAGTG -3'

Sequencing Primer
(F):5'- CTCTGTAGGTCTAGTTCTATGGACTC -3'
(R):5'- CAGTCAGTGGAGCACAGTTTAC -3'
Posted On2015-01-23