Mutagenetix > Incidental Mutations

Incidental Mutation 'R0329:Kif14'

25932

Institutional Source

Beutler Lab

Gene Symbol

Kif14

Ensembl Gene

ENSMUSG00000041498

Gene Name

kinesin family member 14

Synonyms

N-3 kinesin, D1Ertd367e

MMRRC Submission

038538-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R0329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136466343-136531511 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to C at 136496026 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]

Predicted Effect

probably benign
Transcript: ENSMUST00000047817

SMART Domains

Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498

Domain	Start	End	E-Value	Type
KISc	341	694	1.45e-180	SMART
FHA	809	861	1.46e-7	SMART
coiled coil region	911	1060	N/A	INTRINSIC
low complexity region	1169	1179	N/A	INTRINSIC
low complexity region	1548	1559	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187963

Predicted Effect

probably benign
Transcript: ENSMUST00000189413

SMART Domains

Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	744	1.45e-180	SMART
FHA	859	911	1.46e-7	SMART
coiled coil region	961	1110	N/A	INTRINSIC
low complexity region	1219	1229	N/A	INTRINSIC
low complexity region	1598	1609	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201676

SMART Domains

Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	497	3.7e-6	SMART

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 95.0%
20x: 89.0%

Validation Efficiency

99% (107/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,883,631	I400F	probably benign	Het
4833423E24Rik	T	A	2: 85,518,551	R72S	probably benign	Het
4931409K22Rik	T	C	5: 24,545,785		probably null	Het
Abca13	A	T	11: 9,399,430	H3668L	probably damaging	Het
Acvr1c	T	C	2: 58,284,838	T313A	probably damaging	Het
Adam28	T	C	14: 68,617,739	K651R	probably damaging	Het
Adamtsl3	A	T	7: 82,521,990	D417V	probably damaging	Het
Adgrf4	A	T	17: 42,667,313	C380S	probably damaging	Het
AI597479	T	G	1: 43,111,117	L129R	probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Anxa7	A	C	14: 20,469,498		probably null	Het
Arhgap22	A	G	14: 33,369,417	R650G	possibly damaging	Het
Atp8a1	T	A	5: 67,812,073		probably benign	Het
Bcr	C	T	10: 75,181,634	T1209I	possibly damaging	Het
Bmpr1a	C	T	14: 34,429,777	S185N	probably benign	Het
Calcoco1	A	T	15: 102,715,763	M246K	probably benign	Het
Casp12	T	A	9: 5,345,534		probably benign	Het
Ccno	T	A	13: 112,989,996	L333Q	probably damaging	Het
Cdhr2	T	A	13: 54,734,801		probably benign	Het
Cftr	T	A	6: 18,226,097	M318K	probably null	Het
Ckmt2	T	A	13: 91,863,203	D96V	possibly damaging	Het
Cnnm1	C	T	19: 43,441,910	P489L	probably damaging	Het
Cntnap1	A	T	11: 101,188,309	D1175V	probably damaging	Het
Cpne5	A	T	17: 29,211,660	L92H	probably damaging	Het
Crcp	C	A	5: 130,042,242	Q61K	possibly damaging	Het
Dcaf8	T	A	1: 172,187,411	D414E	probably benign	Het
Ddx28	T	C	8: 106,010,245	T394A	probably benign	Het
Ddx55	T	C	5: 124,559,147	F191L	probably benign	Het
Dnaaf1	T	C	8: 119,596,017		probably benign	Het
Dnaaf2	C	A	12: 69,197,744	R181L	probably damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elf5	A	G	2: 103,430,420		probably benign	Het
Emcn	T	A	3: 137,416,814		probably benign	Het
Erbb4	T	C	1: 68,298,280		probably benign	Het
Erbin	C	A	13: 103,868,865	C114F	probably damaging	Het
Etfdh	T	C	3: 79,609,844	I353V	probably benign	Het
Fam172a	T	A	13: 77,761,951		probably benign	Het
Fbxl12	C	T	9: 20,638,480	G316D	probably damaging	Het
Gbf1	G	A	19: 46,272,270		probably null	Het
Gbp2b	T	G	3: 142,608,176	S406A	probably benign	Het
Gli3	T	G	13: 15,723,558	L741R	probably damaging	Het
Gmip	G	T	8: 69,810,818	S70I	probably benign	Het
Gnptab	T	C	10: 88,440,309	S1153P	probably damaging	Het
Gp1ba	A	G	11: 70,640,409		probably benign	Het
Gramd1a	T	C	7: 31,138,254	D360G	possibly damaging	Het
Hectd4	T	C	5: 121,259,864	I285T	probably benign	Het
Hrh4	A	G	18: 13,007,245		probably benign	Het
Hsp90b1	T	C	10: 86,694,155	E226G	probably damaging	Het
Hspa13	A	T	16: 75,765,130	D60E	probably damaging	Het
Htt	T	A	5: 34,817,134		probably benign	Het
Ispd	C	T	12: 36,381,838	A22V	possibly damaging	Het
Kit	T	G	5: 75,652,829	V888G	probably damaging	Het
Lpin3	T	C	2: 160,905,305	V827A	probably benign	Het
Lrriq4	T	C	3: 30,655,724	S406P	probably benign	Het
Man2c1	T	C	9: 57,141,183	V777A	probably benign	Het
Mcm8	A	G	2: 132,819,994	K83E	possibly damaging	Het
Mep1a	A	G	17: 43,497,898		probably null	Het
Mtor	T	A	4: 148,484,380	V1119E	probably benign	Het
Mybpc2	C	T	7: 44,509,029	A710T	possibly damaging	Het
Myo9a	C	G	9: 59,923,677	T2368S	probably damaging	Het
Nbeal1	A	G	1: 60,268,063	Y1684C	probably damaging	Het
Npm3	A	G	19: 45,749,526	F11L	probably benign	Het
Nutf2	T	A	8: 105,876,363	S37T	probably damaging	Het
Obscn	T	A	11: 59,040,441	I5790F	probably damaging	Het
Obscn	A	T	11: 59,052,506	D4833E	probably damaging	Het
Olfr1015	T	A	2: 85,785,803	C97*	probably null	Het
Olfr123	A	T	17: 37,795,989	M182L	probably benign	Het
Olfr39	T	A	9: 20,285,857	S61T	possibly damaging	Het
Olfr955	T	C	9: 39,470,556	T57A	possibly damaging	Het
Pcdhb1	A	G	18: 37,267,024	D676G	possibly damaging	Het
Pcif1	G	T	2: 164,889,444	R466L	probably damaging	Het
Pdk1	T	C	2: 71,895,674		probably benign	Het
Phxr2	T	C	10: 99,126,117		probably benign	Het
Pidd1	A	T	7: 141,439,561		probably benign	Het
Plec	A	G	15: 76,191,418		probably null	Het
Polr1a	T	A	6: 71,966,416	C1212S	possibly damaging	Het
Pot1a	A	G	6: 25,778,831		probably benign	Het
Prdm5	T	C	6: 65,862,903		probably benign	Het
Primpol	A	T	8: 46,610,461	N53K	probably damaging	Het
Pyroxd1	A	G	6: 142,361,976	I491V	probably benign	Het
Serpinb3b	G	T	1: 107,159,703	N25K	probably damaging	Het
Slc9b1	C	T	3: 135,373,235	R218*	probably null	Het
Ssbp2	T	A	13: 91,680,579		probably null	Het
Stat4	A	G	1: 52,090,870		probably benign	Het
Steap4	T	C	5: 7,975,829	V130A	possibly damaging	Het
Stoml2	A	G	4: 43,030,238		probably null	Het
Syne2	G	T	12: 75,966,953	G2974C	probably benign	Het
Tfdp2	T	G	9: 96,306,893	F200V	probably damaging	Het
Tgm4	T	C	9: 123,048,557		probably null	Het
Tie1	C	A	4: 118,484,727	R175L	probably benign	Het
Tmem145	A	G	7: 25,308,674		probably benign	Het
Tsacc	A	G	3: 88,282,862	S94P	possibly damaging	Het
Tshz3	T	A	7: 36,770,033	D482E	probably benign	Het
Tspan33	T	C	6: 29,711,092		probably null	Het
Ugt2b35	A	G	5: 87,003,405	K290R	probably null	Het
Unc80	T	C	1: 66,674,087	L2788P	possibly damaging	Het
Usp10	T	A	8: 119,936,557	C39*	probably null	Het
Utp20	T	A	10: 88,817,979	T260S	probably benign	Het
Vmn2r118	G	T	17: 55,610,717	T265K	probably damaging	Het
Vmn2r7	C	A	3: 64,691,018	C797F	probably damaging	Het
Vmn2r98	A	C	17: 19,066,347	H369P	probably benign	Het
Vps39	A	T	2: 120,338,787	Y245N	possibly damaging	Het
Wdr27	A	G	17: 14,934,459		probably benign	Het
Ythdc2	A	G	18: 44,865,060		probably benign	Het
Zcwpw2	C	A	9: 118,014,055		noncoding transcript	Het
Zdhhc1	C	A	8: 105,483,543	A81S	probably benign	Het
Zfp729a	G	T	13: 67,620,354	H585Q	probably damaging	Het

Other mutations in Kif14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00159:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00160:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00164:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00310:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00330:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00335:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00434:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00468:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL01330:Kif14	APN	1	136476374	missense	probably damaging	0.99
IGL01530:Kif14	APN	1	136478419	splice site	probably benign
IGL01622:Kif14	APN	1	136497356	splice site	probably benign
IGL01689:Kif14	APN	1	136519642	missense	probably damaging	0.99
IGL02115:Kif14	APN	1	136496567	splice site	probably benign
IGL02252:Kif14	APN	1	136478392	missense	probably damaging	1.00
IGL02259:Kif14	APN	1	136500102	missense	probably benign
IGL02439:Kif14	APN	1	136490261	missense	probably damaging	1.00
IGL02590:Kif14	APN	1	136496004	missense	probably benign	0.00
IGL02606:Kif14	APN	1	136496593	missense	probably damaging	1.00
IGL03253:Kif14	APN	1	136487460	missense	probably damaging	0.97
R0106:Kif14	UTSW	1	136479924	splice site	probably benign
R0193:Kif14	UTSW	1	136468438	missense	probably benign	0.00
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0346:Kif14	UTSW	1	136468160	missense	probably damaging	1.00
R0393:Kif14	UTSW	1	136482418	missense	probably damaging	1.00
R0519:Kif14	UTSW	1	136469147	missense	probably damaging	1.00
R0590:Kif14	UTSW	1	136482472	missense	probably damaging	0.97
R0633:Kif14	UTSW	1	136527305	missense	probably damaging	0.96
R0657:Kif14	UTSW	1	136469102	missense	probably benign	0.07
R0831:Kif14	UTSW	1	136525871	splice site	probably benign
R0971:Kif14	UTSW	1	136519654	missense	probably damaging	0.98
R1018:Kif14	UTSW	1	136495841	splice site	probably benign
R1520:Kif14	UTSW	1	136503324	missense	probably benign	0.00
R1713:Kif14	UTSW	1	136527464	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136468279	missense	probably benign
R1728:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1728:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136490332	missense	probably benign
R1728:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1728:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1728:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1729:Kif14	UTSW	1	136468279	missense	probably benign
R1729:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1729:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1729:Kif14	UTSW	1	136490332	missense	probably benign
R1729:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1729:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1729:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1730:Kif14	UTSW	1	136468279	missense	probably benign
R1730:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1730:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1730:Kif14	UTSW	1	136490332	missense	probably benign
R1730:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1730:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1730:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1739:Kif14	UTSW	1	136468279	missense	probably benign
R1739:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1739:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1739:Kif14	UTSW	1	136490332	missense	probably benign
R1739:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1739:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1739:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1762:Kif14	UTSW	1	136468279	missense	probably benign
R1762:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1762:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1762:Kif14	UTSW	1	136490332	missense	probably benign
R1762:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1762:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1762:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1783:Kif14	UTSW	1	136468279	missense	probably benign
R1783:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1783:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1783:Kif14	UTSW	1	136490332	missense	probably benign
R1783:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1783:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1783:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1784:Kif14	UTSW	1	136468279	missense	probably benign
R1784:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1784:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1784:Kif14	UTSW	1	136490332	missense	probably benign
R1784:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1784:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1784:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1785:Kif14	UTSW	1	136468279	missense	probably benign
R1785:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1785:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1785:Kif14	UTSW	1	136490332	missense	probably benign
R1785:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1785:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1785:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1872:Kif14	UTSW	1	136486358	missense	probably damaging	1.00
R2049:Kif14	UTSW	1	136487080	missense	probably benign
R2049:Kif14	UTSW	1	136510167	missense	possibly damaging	0.68
R2268:Kif14	UTSW	1	136519748	nonsense	probably null
R2373:Kif14	UTSW	1	136479845	missense	probably damaging	1.00
R3076:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3077:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3078:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R4232:Kif14	UTSW	1	136516363	nonsense	probably null
R4246:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4247:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4250:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4672:Kif14	UTSW	1	136521278	missense	probably benign	0.00
R4672:Kif14	UTSW	1	136521279	missense	probably benign
R4890:Kif14	UTSW	1	136487130	missense	possibly damaging	0.91
R4994:Kif14	UTSW	1	136482959	missense	probably damaging	1.00
R5102:Kif14	UTSW	1	136516403	missense	probably benign	0.00
R5185:Kif14	UTSW	1	136527469	nonsense	probably null
R5201:Kif14	UTSW	1	136503407	missense	probably benign	0.00
R5399:Kif14	UTSW	1	136503324	missense	probably benign	0.00
R5431:Kif14	UTSW	1	136496695	missense	possibly damaging	0.91
R5932:Kif14	UTSW	1	136516390	missense	probably benign	0.23
R6027:Kif14	UTSW	1	136483059	splice site	probably null
R6246:Kif14	UTSW	1	136476424	nonsense	probably null
R6331:Kif14	UTSW	1	136515986	missense	probably null	1.00
R6448:Kif14	UTSW	1	136503347	missense	probably damaging	0.99
R6453:Kif14	UTSW	1	136482304	splice site	probably null
R6475:Kif14	UTSW	1	136527411	missense	probably damaging	1.00
R6631:Kif14	UTSW	1	136515959	missense	probably benign	0.39
R6713:Kif14	UTSW	1	136525806	missense	probably benign
R7173:Kif14	UTSW	1	136479170	missense	probably damaging	0.98
R7174:Kif14	UTSW	1	136521257	missense	possibly damaging	0.67
R7241:Kif14	UTSW	1	136468753	missense	probably benign	0.41
R7674:Kif14	UTSW	1	136468820	missense	probably damaging	0.99
R7688:Kif14	UTSW	1	136494654	missense	probably damaging	1.00
R7711:Kif14	UTSW	1	136471453	missense	probably benign	0.10
R7722:Kif14	UTSW	1	136468295	missense	probably benign	0.00
R7763:Kif14	UTSW	1	136516383	missense	probably benign	0.00
R7882:Kif14	UTSW	1	136471576	critical splice donor site	probably null
R7882:Kif14	UTSW	1	136516025	missense	probably benign	0.43
R8077:Kif14	UTSW	1	136471448	missense	possibly damaging	0.87
R8101:Kif14	UTSW	1	136476352	missense	probably benign	0.14
R8308:Kif14	UTSW	1	136515913	missense	possibly damaging	0.90
R8338:Kif14	UTSW	1	136494678	missense	probably damaging	1.00
X0021:Kif14	UTSW	1	136490276	missense	probably damaging	1.00
Z1176:Kif14	UTSW	1	136496653	missense	probably damaging	0.97
Z1176:Kif14	UTSW	1	136500016	critical splice acceptor site	probably null
Z1177:Kif14	UTSW	1	136478365	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGTCATCGTAAACTGTGGAGTTAGAGG -3'
(R):5'- GAGGTCTGCCGAAGCATCTGTC -3'

Sequencing Primer
(F):5'- gcatgaaaacagagcactcatac -3'
(R):5'- CCGAAGCATCTGTCCTCTTG -3'

Posted On

2013-04-16