Incidental Mutation 'R3405:Uvssa'
List |< first << previous [record 44 of 47] next >> last >|
ID259324
Institutional Source Beutler Lab
Gene Symbol Uvssa
Ensembl Gene ENSMUSG00000037355
Gene NameUV stimulated scaffold protein A
SynonymsD330017J19Rik, 4933407H18Rik
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33378549-33419754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33389818 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 243 (G243C)
Ref Sequence ENSEMBL: ENSMUSP00000144025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087864] [ENSMUST00000202046] [ENSMUST00000202816]
Predicted Effect probably damaging
Transcript: ENSMUST00000087864
AA Change: G243C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085170
Gene: ENSMUSG00000037355
AA Change: G243C

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153980
AA Change: W469L
Predicted Effect not run
Transcript: ENSMUST00000185821
AA Change: G243C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200682
Predicted Effect probably damaging
Transcript: ENSMUST00000202046
AA Change: G243C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144025
Gene: ENSMUSG00000037355
AA Change: G243C

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202816
AA Change: G243C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144400
Gene: ENSMUSG00000037355
AA Change: G243C

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Meta Mutation Damage Score 0.1100 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex, and is thought to be involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway to help remove lesions in the DNA that block transcription. Defects in this gene can cause UV-sensitive syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Uvssa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Uvssa APN 5 33408848 missense probably benign 0.00
IGL02136:Uvssa APN 5 33391848 missense probably damaging 1.00
IGL02339:Uvssa APN 5 33414849 missense probably damaging 1.00
IGL03096:Uvssa APN 5 33410924 missense probably benign 0.29
IGL03130:Uvssa APN 5 33391845 missense possibly damaging 0.57
IGL03248:Uvssa APN 5 33391816 missense probably damaging 1.00
PIT1430001:Uvssa UTSW 5 33402570 missense possibly damaging 0.50
PIT4142001:Uvssa UTSW 5 33392084 missense probably benign 0.05
R0326:Uvssa UTSW 5 33408847 missense probably benign 0.01
R0443:Uvssa UTSW 5 33388824 missense possibly damaging 0.68
R1438:Uvssa UTSW 5 33413884 splice site probably benign
R1474:Uvssa UTSW 5 33388821 missense probably benign 0.00
R1521:Uvssa UTSW 5 33413934 missense probably damaging 0.99
R1522:Uvssa UTSW 5 33387808 missense probably damaging 1.00
R1839:Uvssa UTSW 5 33389752 missense probably benign 0.00
R2223:Uvssa UTSW 5 33392063 missense probably damaging 1.00
R3404:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3406:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3892:Uvssa UTSW 5 33389752 missense probably benign 0.04
R4624:Uvssa UTSW 5 33389956 missense possibly damaging 0.87
R4898:Uvssa UTSW 5 33413913 nonsense probably null
R5413:Uvssa UTSW 5 33410908 missense probably damaging 1.00
R5921:Uvssa UTSW 5 33389752 missense probably benign 0.00
R5977:Uvssa UTSW 5 33389860 missense probably damaging 1.00
R6198:Uvssa UTSW 5 33409510 missense probably damaging 1.00
R6566:Uvssa UTSW 5 33392176 missense possibly damaging 0.66
R6884:Uvssa UTSW 5 33409117 intron probably null
R8022:Uvssa UTSW 5 33409504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATCTCAATGTCTGCAGAAATG -3'
(R):5'- GGACTTCAACATCCAGCGTG -3'

Sequencing Primer
(F):5'- GTATGATGAAATTGAATGCTGCCTG -3'
(R):5'- CAACATCCAGCGTGTACTTGTGG -3'
Posted On2015-01-23