Incidental Mutation 'R3405:Dhodh'
List |< first << previous [record 7 of 47] next >> last >|
ID259331
Institutional Source Beutler Lab
Gene Symbol Dhodh
Ensembl Gene ENSMUSG00000031730
Gene Namedihydroorotate dehydrogenase
Synonyms
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109591343-109608673 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 109603475 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 86 (R86*)
Ref Sequence ENSEMBL: ENSMUSP00000115549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123605] [ENSMUST00000128350] [ENSMUST00000143900] [ENSMUST00000150804]
Predicted Effect probably null
Transcript: ENSMUST00000069058
AA Change: R88*
SMART Domains Protein: ENSMUSP00000070303
Gene: ENSMUSG00000031730
AA Change: R88*

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DHO_dh 77 377 1.1e-116 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123605
AA Change: R88*
SMART Domains Protein: ENSMUSP00000115934
Gene: ENSMUSG00000031730
AA Change: R88*

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DHO_dh 77 377 2e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125779
Predicted Effect probably null
Transcript: ENSMUST00000128350
AA Change: R47*
SMART Domains Protein: ENSMUSP00000118612
Gene: ENSMUSG00000031730
AA Change: R47*

DomainStartEndE-ValueType
Pfam:DHO_dh 36 103 2.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131107
Predicted Effect probably null
Transcript: ENSMUST00000133353
AA Change: R18*
SMART Domains Protein: ENSMUSP00000114190
Gene: ENSMUSG00000031730
AA Change: R18*

DomainStartEndE-ValueType
Pfam:DHO_dh 8 85 2.6e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143900
AA Change: R88*
SMART Domains Protein: ENSMUSP00000117980
Gene: ENSMUSG00000031730
AA Change: R88*

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DHO_dh 77 277 1.8e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146064
Predicted Effect probably null
Transcript: ENSMUST00000150804
AA Change: R86*
SMART Domains Protein: ENSMUSP00000115549
Gene: ENSMUSG00000031730
AA Change: R86*

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:DHO_dh 75 162 7.2e-32 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the fourth enzymatic step, the ubiquinone-mediated oxidation of dihydroorotate to orotate, in de novo pyrimidine biosynthesis. This protein is a mitochondrial protein located on the outer surface of the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Dhodh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Dhodh APN 8 109594764 missense probably damaging 1.00
IGL02514:Dhodh APN 8 109606264 nonsense probably null
R2268:Dhodh UTSW 8 109594674 missense possibly damaging 0.94
R3406:Dhodh UTSW 8 109603475 nonsense probably null
R3875:Dhodh UTSW 8 109594960 missense probably null 0.01
R4694:Dhodh UTSW 8 109606416 missense probably damaging 1.00
R4709:Dhodh UTSW 8 109601538 intron probably null
R5130:Dhodh UTSW 8 109595756 missense possibly damaging 0.75
R5215:Dhodh UTSW 8 109606343 unclassified probably benign
R5880:Dhodh UTSW 8 109594777 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTCTTCCATCAGAGATCCC -3'
(R):5'- TCAGAGTGTCCTTCCCCTAG -3'

Sequencing Primer
(F):5'- ATAGCTCTGTGACGCTAAGC -3'
(R):5'- CCTAGAAGATCCTTATTCTGGGGGAC -3'
Posted On2015-01-23