Incidental Mutation 'R3405:Nrp1'
ID259332
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Nameneuropilin 1
SynonymsNeuropilin-1, NP-1, NPN-1, Npn1
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location128358604-128503363 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128498088 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 777 (Y777*)
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
PDB Structure
Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000026917
AA Change: Y777*
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: Y777*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 128476207 missense probably benign
IGL01412:Nrp1 APN 8 128418707 splice site probably benign
IGL01586:Nrp1 APN 8 128432032 missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 128502720 missense probably damaging 1.00
IGL02500:Nrp1 APN 8 128425799 missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 128493031 missense probably benign
R0046:Nrp1 UTSW 8 128500608 splice site probably benign
R0281:Nrp1 UTSW 8 128460683 missense probably damaging 0.96
R0403:Nrp1 UTSW 8 128457969 missense probably damaging 1.00
R0610:Nrp1 UTSW 8 128502618 missense probably damaging 1.00
R1055:Nrp1 UTSW 8 128468598 missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 128418716 nonsense probably null
R1263:Nrp1 UTSW 8 128468389 missense probably damaging 1.00
R1340:Nrp1 UTSW 8 128434355 missense probably damaging 1.00
R1397:Nrp1 UTSW 8 128418716 nonsense probably null
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1531:Nrp1 UTSW 8 128425969 missense probably null 0.19
R1587:Nrp1 UTSW 8 128476282 missense probably damaging 1.00
R1719:Nrp1 UTSW 8 128425885 missense probably damaging 1.00
R1733:Nrp1 UTSW 8 128468493 missense probably benign 0.02
R1785:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R1786:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2047:Nrp1 UTSW 8 128498096 splice site probably benign
R2130:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2132:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2133:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2163:Nrp1 UTSW 8 128497871 missense probably damaging 1.00
R2338:Nrp1 UTSW 8 128497904 missense probably benign 0.01
R2407:Nrp1 UTSW 8 128431945 missense probably damaging 0.99
R3748:Nrp1 UTSW 8 128457980 missense probably damaging 1.00
R4347:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R4379:Nrp1 UTSW 8 128468467 missense probably damaging 1.00
R4646:Nrp1 UTSW 8 128457944 missense probably benign 0.00
R4688:Nrp1 UTSW 8 128502566 missense probably benign 0.01
R4916:Nrp1 UTSW 8 128502804 nonsense probably null
R5077:Nrp1 UTSW 8 128500673 critical splice donor site probably null
R5301:Nrp1 UTSW 8 128434197 splice site probably null
R5509:Nrp1 UTSW 8 128425915 missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 128468448 missense probably benign 0.22
R5873:Nrp1 UTSW 8 128468377 missense probably damaging 1.00
R5987:Nrp1 UTSW 8 128476169 missense probably damaging 1.00
R6060:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
R6757:Nrp1 UTSW 8 128425868 missense probably damaging 1.00
R6889:Nrp1 UTSW 8 128493057 missense probably damaging 1.00
R7025:Nrp1 UTSW 8 128480954 missense probably damaging 1.00
R7065:Nrp1 UTSW 8 128460712 missense probably benign
R7290:Nrp1 UTSW 8 128476296 critical splice donor site probably null
R7369:Nrp1 UTSW 8 128431915 missense probably damaging 1.00
R7553:Nrp1 UTSW 8 128431987 missense probably damaging 1.00
R7650:Nrp1 UTSW 8 128498014 missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 128432023 missense probably benign 0.00
X0066:Nrp1 UTSW 8 128460645 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTCTGCCCACTGTATGAC -3'
(R):5'- AGTGGTAGAGATGATTCAAACATGC -3'

Sequencing Primer
(F):5'- ACCTTCTGGTATCACATGTCCGG -3'
(R):5'- GGGATGCTATCTATGACATCTCAG -3'
Posted On2015-01-23