Incidental Mutation 'R3405:Hormad2'
ID259336
Institutional Source Beutler Lab
Gene Symbol Hormad2
Ensembl Gene ENSMUSG00000020419
Gene NameHORMA domain containing 2
Synonyms
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4345814-4441105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4424302 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 88 (Q88P)
Ref Sequence ENSEMBL: ENSMUSP00000105575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020689] [ENSMUST00000109948] [ENSMUST00000109949] [ENSMUST00000130174]
Predicted Effect probably benign
Transcript: ENSMUST00000020689
SMART Domains Protein: ENSMUSP00000020689
Gene: ENSMUSG00000020419

DomainStartEndE-ValueType
Pfam:HORMA 27 65 1.9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109948
AA Change: Q88P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105574
Gene: ENSMUSG00000020419
AA Change: Q88P

DomainStartEndE-ValueType
Pfam:HORMA 28 226 8.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109949
AA Change: Q88P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105575
Gene: ENSMUSG00000020419
AA Change: Q88P

DomainStartEndE-ValueType
Pfam:HORMA 27 226 6.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124249
Predicted Effect probably damaging
Transcript: ENSMUST00000130174
AA Change: Q88P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121715
Gene: ENSMUSG00000020419
AA Change: Q88P

DomainStartEndE-ValueType
Pfam:HORMA 27 103 6.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149443
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to arrest of spermatogenesis, male infertility, and abnormalities in male and female meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Hormad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02245:Hormad2 APN 11 4408580 splice site probably benign
R0116:Hormad2 UTSW 11 4412206 splice site probably benign
R0504:Hormad2 UTSW 11 4408833 missense possibly damaging 0.78
R0925:Hormad2 UTSW 11 4427297 missense probably damaging 1.00
R1344:Hormad2 UTSW 11 4409005 critical splice donor site probably null
R1418:Hormad2 UTSW 11 4409005 critical splice donor site probably null
R1512:Hormad2 UTSW 11 4424788 missense probably damaging 1.00
R1562:Hormad2 UTSW 11 4408848 splice site probably null
R2158:Hormad2 UTSW 11 4424808 nonsense probably null
R3727:Hormad2 UTSW 11 4408598 missense probably benign
R3903:Hormad2 UTSW 11 4427237 splice site probably benign
R6277:Hormad2 UTSW 11 4421583 splice site probably null
R7468:Hormad2 UTSW 11 4412245 nonsense probably null
R7633:Hormad2 UTSW 11 4346662 missense probably benign 0.00
R7912:Hormad2 UTSW 11 4408841 missense probably damaging 1.00
R7993:Hormad2 UTSW 11 4408841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGTCCAGTGACTTCAGAGG -3'
(R):5'- ACCATTCTGTGCTGGGAAGAG -3'

Sequencing Primer
(F):5'- GTCCAGTGACTTCAGAGGAAATTCTG -3'
(R):5'- CTGGGAAGAGAGAGAACACTTCTG -3'
Posted On2015-01-23