Incidental Mutation 'R3405:Gsdma'
List |< first << previous [record 15 of 47] next >> last >|
ID259338
Institutional Source Beutler Lab
Gene Symbol Gsdma
Ensembl Gene ENSMUSG00000017204
Gene Namegasdermin A
SynonymsGsdm1, H312E, Gsdm, Gsdma1
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98664351-98677708 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 98673138 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017348]
Predicted Effect probably benign
Transcript: ENSMUST00000017348
SMART Domains Protein: ENSMUSP00000017348
Gene: ENSMUSG00000017204

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 2.2e-147 PFAM
low complexity region 429 443 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Gsdma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Gsdma APN 11 98673687 missense probably damaging 0.98
IGL02573:Gsdma APN 11 98670751 splice site probably benign
IGL03005:Gsdma APN 11 98676259 missense probably damaging 0.97
R0143:Gsdma UTSW 11 98666254 missense probably damaging 0.96
R1337:Gsdma UTSW 11 98669707 nonsense probably null
R1533:Gsdma UTSW 11 98676384 missense unknown
R1605:Gsdma UTSW 11 98666493 missense probably damaging 0.98
R1929:Gsdma UTSW 11 98671367 critical splice donor site probably null
R1998:Gsdma UTSW 11 98673694 missense probably damaging 0.99
R2043:Gsdma UTSW 11 98666220 missense possibly damaging 0.94
R2114:Gsdma UTSW 11 98673012 missense probably damaging 1.00
R3404:Gsdma UTSW 11 98673138 splice site probably benign
R3406:Gsdma UTSW 11 98673138 splice site probably benign
R3711:Gsdma UTSW 11 98666219 nonsense probably null
R3764:Gsdma UTSW 11 98670767 missense probably damaging 0.98
R4656:Gsdma UTSW 11 98673081 missense probably damaging 1.00
R5384:Gsdma UTSW 11 98666449 critical splice acceptor site probably null
R5943:Gsdma UTSW 11 98673026 missense probably benign 0.30
R7620:Gsdma UTSW 11 98666603 missense probably benign 0.06
X0017:Gsdma UTSW 11 98666270 critical splice donor site probably benign
Z1176:Gsdma UTSW 11 98669759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCTGAAAGGGTGCCAG -3'
(R):5'- CTGTACTGATGCTCTTCTTTCAGGG -3'

Sequencing Primer
(F):5'- ATTAACTGTGCCCCTAGG -3'
(R):5'- GCTCTTCTTTCAGGGATAAAAGG -3'
Posted On2015-01-23