Incidental Mutation 'R3405:Cdc27'
ID259339
Institutional Source Beutler Lab
Gene Symbol Cdc27
Ensembl Gene ENSMUSG00000020687
Gene Namecell division cycle 27
SynonymsAPC3
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104502745-104550620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104507200 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 778 (E778G)
Ref Sequence ENSEMBL: ENSMUSP00000091452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093923] [ENSMUST00000106962]
Predicted Effect probably damaging
Transcript: ENSMUST00000093923
AA Change: E778G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091452
Gene: ENSMUSG00000020687
AA Change: E778G

DomainStartEndE-ValueType
Pfam:Apc3 17 95 2.2e-23 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 349 362 N/A INTRINSIC
TPR 500 533 1.33e1 SMART
TPR 568 601 2.91e-6 SMART
TPR 602 635 7.06e-5 SMART
TPR 636 669 3.96e-8 SMART
TPR 670 703 7.45e-4 SMART
TPR 704 737 6.92e1 SMART
TPR 738 771 1.17e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106962
AA Change: E784G

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102575
Gene: ENSMUSG00000020687
AA Change: E784G

DomainStartEndE-ValueType
Pfam:ANAPC3 17 94 7.7e-25 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 355 368 N/A INTRINSIC
TPR 506 539 1.33e1 SMART
TPR 574 607 2.91e-6 SMART
TPR 608 641 7.06e-5 SMART
TPR 642 675 3.96e-8 SMART
TPR 676 709 7.45e-4 SMART
TPR 710 743 6.92e1 SMART
TPR 744 777 1.17e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127506
Meta Mutation Damage Score 0.3552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of the anaphase-promoting complex (APC), which is composed of eight protein subunits and is highly conserved in eukaryotic cells. This complex catalyzes the formation of cyclin B-ubiquitin conjugate, which is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. The protein encoded by this gene and three other members of the APC complex contain tetratricopeptide (TPR) repeats, which are important for protein-protein interactions. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and it may thus be involved in controlling the timing of mitosis. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 22 and Y. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Cdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cdc27 APN 11 104521432 missense probably benign 0.01
IGL00673:Cdc27 APN 11 104528435 missense probably damaging 1.00
IGL00949:Cdc27 APN 11 104529403 missense probably damaging 1.00
IGL01529:Cdc27 APN 11 104507216 missense probably damaging 1.00
IGL01894:Cdc27 APN 11 104526921 missense probably benign 0.00
IGL02096:Cdc27 APN 11 104528568 splice site probably benign
IGL02124:Cdc27 APN 11 104522731 missense probably damaging 0.99
IGL02444:Cdc27 APN 11 104522716 splice site probably benign
IGL02589:Cdc27 APN 11 104505644 missense probably benign 0.04
IGL02851:Cdc27 APN 11 104526981 splice site probably benign
IGL02861:Cdc27 APN 11 104522831 splice site probably benign
IGL02952:Cdc27 APN 11 104517464 missense probably damaging 1.00
IGL03103:Cdc27 APN 11 104512980 missense probably benign 0.21
R0344:Cdc27 UTSW 11 104526991 splice site probably benign
R0365:Cdc27 UTSW 11 104528424 missense possibly damaging 0.68
R0366:Cdc27 UTSW 11 104505648 missense probably damaging 0.99
R0426:Cdc27 UTSW 11 104513027 splice site probably null
R0505:Cdc27 UTSW 11 104528288 missense probably benign
R0639:Cdc27 UTSW 11 104531734 missense probably damaging 1.00
R0925:Cdc27 UTSW 11 104526049 critical splice donor site probably null
R0927:Cdc27 UTSW 11 104505641 missense possibly damaging 0.88
R1414:Cdc27 UTSW 11 104521425 missense probably benign 0.26
R1765:Cdc27 UTSW 11 104534781 missense probably damaging 1.00
R1822:Cdc27 UTSW 11 104522822 missense probably benign 0.16
R2449:Cdc27 UTSW 11 104505638 missense probably benign 0.03
R3404:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3406:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3776:Cdc27 UTSW 11 104515437 missense probably damaging 1.00
R4037:Cdc27 UTSW 11 104507207 missense probably damaging 1.00
R4385:Cdc27 UTSW 11 104534814 missense probably benign 0.10
R4451:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4452:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4530:Cdc27 UTSW 11 104528426 missense possibly damaging 0.68
R4956:Cdc27 UTSW 11 104529395 missense probably damaging 0.99
R4988:Cdc27 UTSW 11 104526124 missense possibly damaging 0.95
R5098:Cdc27 UTSW 11 104507287 missense probably damaging 1.00
R5130:Cdc27 UTSW 11 104534774 missense probably benign 0.07
R5384:Cdc27 UTSW 11 104507140 missense probably benign 0.02
R5876:Cdc27 UTSW 11 104515418 missense probably benign 0.30
R6238:Cdc27 UTSW 11 104528444 missense probably damaging 1.00
R6318:Cdc27 UTSW 11 104528694 missense probably damaging 1.00
R6354:Cdc27 UTSW 11 104534748 missense probably damaging 1.00
R6467:Cdc27 UTSW 11 104522776 missense probably damaging 1.00
R6485:Cdc27 UTSW 11 104505648 missense probably benign 0.15
R7237:Cdc27 UTSW 11 104517419 missense probably benign
R7315:Cdc27 UTSW 11 104515444 missense possibly damaging 0.95
R7534:Cdc27 UTSW 11 104508414 missense probably damaging 1.00
R7838:Cdc27 UTSW 11 104513004 missense probably damaging 0.98
R7921:Cdc27 UTSW 11 104513004 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACAGAGCTGAGGTTCAAGG -3'
(R):5'- ACCTGAATGGGCTTGTACTTC -3'

Sequencing Primer
(F):5'- TGAGGTTCAAGGCCACAC -3'
(R):5'- GGCTTGTACTTCAAAGATCAGAAGCC -3'
Posted On2015-01-23