Incidental Mutation 'R3405:Rbfox3'
List |< first << previous [record 37 of 47] next >> last >|
ID259340
Institutional Source Beutler Lab
Gene Symbol Rbfox3
Ensembl Gene ENSMUSG00000025576
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 3
SynonymsD11Bwg0517e, NeuN, Neuna60, Hrnbp3
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R3405 (G1)
Quality Score213
Status Validated
Chromosome11
Chromosomal Location118489762-118911597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118496457 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 277 (Q277L)
Ref Sequence ENSEMBL: ENSMUSP00000113636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017576] [ENSMUST00000069343] [ENSMUST00000103023] [ENSMUST00000106278] [ENSMUST00000117731] [ENSMUST00000120061] [ENSMUST00000154746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017576
AA Change: Q277L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017576
Gene: ENSMUSG00000025576
AA Change: Q277L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 208 269 1e-22 PFAM
Pfam:Fox-1_C 279 345 3.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069343
AA Change: Q246L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069598
Gene: ENSMUSG00000025576
AA Change: Q246L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 165 8.3e-2 SMART
Pfam:Fox-1_C 176 229 4.1e-15 PFAM
Pfam:Fox-1_C 226 314 4.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103023
SMART Domains Protein: ENSMUSP00000099312
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106278
SMART Domains Protein: ENSMUSP00000101885
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117731
AA Change: Q277L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113636
Gene: ENSMUSG00000025576
AA Change: Q277L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 260 3.5e-15 PFAM
Pfam:Fox-1_C 257 345 4.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120061
SMART Domains Protein: ENSMUSP00000113987
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 6.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154746
SMART Domains Protein: ENSMUSP00000118332
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
RRM 1 54 8.6e-5 SMART
Pfam:Fox-1_C 90 142 5.5e-16 PFAM
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced brain weight, increased susceptibility kainic acid-induced seizures, decreased anxiety-related behaviors, and deficits in synaptic transmission and plasticity in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Rbfox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Rbfox3 APN 11 118505613 splice site probably benign
IGL01622:Rbfox3 APN 11 118505614 splice site probably benign
IGL01623:Rbfox3 APN 11 118505614 splice site probably benign
IGL01716:Rbfox3 APN 11 118513289 missense possibly damaging 0.89
IGL01772:Rbfox3 APN 11 118496971 missense probably damaging 0.98
IGL03162:Rbfox3 APN 11 118496431 missense probably benign 0.06
PIT4431001:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R0267:Rbfox3 UTSW 11 118495240 missense probably benign 0.00
R1659:Rbfox3 UTSW 11 118494155 missense probably damaging 0.99
R1681:Rbfox3 UTSW 11 118505669 missense probably damaging 1.00
R1698:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R1731:Rbfox3 UTSW 11 118496936 critical splice donor site probably null
R2134:Rbfox3 UTSW 11 118497016 missense probably damaging 1.00
R2249:Rbfox3 UTSW 11 118503738 missense probably damaging 0.99
R3051:Rbfox3 UTSW 11 118502888 missense probably damaging 1.00
R3404:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3406:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R5276:Rbfox3 UTSW 11 118496352 missense probably damaging 1.00
R7243:Rbfox3 UTSW 11 118513274 missense probably damaging 1.00
R7797:Rbfox3 UTSW 11 118496484 missense possibly damaging 0.84
X0013:Rbfox3 UTSW 11 118497041 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GATGCCATGGGTCTATGTGC -3'
(R):5'- CTCTACTGCTGAAGAGGACAG -3'

Sequencing Primer
(F):5'- GAAGGGCAGACGGACTTCTC -3'
(R):5'- CTGAAGAGGACAGCTGCCTG -3'
Posted On2015-01-23