Incidental Mutation 'R3405:Map3k4'
ID259349
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Namemitogen-activated protein kinase kinase kinase 4
SynonymsD17Rp17, D17Rp17e, RP17, MAPKKK4, Mekk4, MTK1, Tas
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12227621-12318660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12256781 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 809 (F809Y)
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
Predicted Effect probably damaging
Transcript: ENSMUST00000089058
AA Change: F809Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: F809Y

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Meta Mutation Damage Score 0.3191 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12232990 missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12255200 missense probably benign 0.01
IGL01125:Map3k4 APN 17 12271962 missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12248959 missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12248995 missense probably benign 0.30
IGL02194:Map3k4 APN 17 12263928 missense probably damaging 1.00
IGL02292:Map3k4 APN 17 12235158 missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12249010 missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12271610 missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12264013 missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12235953 missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12271914 missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12272149 missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12238158 missense probably benign 0.01
IGL03238:Map3k4 APN 17 12271158 missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12232976 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0128:Map3k4 UTSW 17 12248063 missense probably damaging 0.99
R0183:Map3k4 UTSW 17 12235128 missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12271015 frame shift probably null
R0355:Map3k4 UTSW 17 12254171 missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12258041 splice site probably benign
R1103:Map3k4 UTSW 17 12237063 splice site probably null
R1446:Map3k4 UTSW 17 12256794 nonsense probably null
R1542:Map3k4 UTSW 17 12235906 missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12249571 missense probably benign 0.39
R1777:Map3k4 UTSW 17 12271730 missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12264019 missense probably benign 0.30
R1997:Map3k4 UTSW 17 12254995 critical splice donor site probably null
R2042:Map3k4 UTSW 17 12277983 missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12264067 missense probably benign 0.00
R2939:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R3930:Map3k4 UTSW 17 12235993 missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12255260 missense probably benign 0.08
R4410:Map3k4 UTSW 17 12248998 missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12232504 missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12264045 missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12232964 missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12248974 missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12271780 missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12272019 missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12271900 missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12249495 critical splice donor site probably null
R4980:Map3k4 UTSW 17 12272071 missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12232434 missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12271610 missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12247308 missense possibly damaging 0.87
R5550:Map3k4 UTSW 17 12243558 nonsense probably null
R5824:Map3k4 UTSW 17 12229639 missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12271416 missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12264058 missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12272067 missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12249583 missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12242692 missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12260491 missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12271344 missense probably damaging 1.00
R6644:Map3k4 UTSW 17 12232410 critical splice donor site probably null
R6909:Map3k4 UTSW 17 12270985 missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12260569 nonsense probably null
R6970:Map3k4 UTSW 17 12248916 missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12271467 missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12272068 missense probably benign 0.00
R7267:Map3k4 UTSW 17 12271649 nonsense probably null
R7322:Map3k4 UTSW 17 12270946 missense probably damaging 1.00
R7522:Map3k4 UTSW 17 12261332 missense probably benign 0.39
R7554:Map3k4 UTSW 17 12232413 missense probably damaging 1.00
R7554:Map3k4 UTSW 17 12232414 nonsense probably null
R7681:Map3k4 UTSW 17 12318543 missense unknown
R7734:Map3k4 UTSW 17 12264111 missense probably damaging 1.00
R7842:Map3k4 UTSW 17 12271143 missense possibly damaging 0.54
R7925:Map3k4 UTSW 17 12271143 missense possibly damaging 0.54
R8013:Map3k4 UTSW 17 12271031 nonsense probably null
R8014:Map3k4 UTSW 17 12271031 nonsense probably null
X0067:Map3k4 UTSW 17 12264094 missense probably benign 0.03
Z1177:Map3k4 UTSW 17 12271697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTTTGGAATGCAGCTG -3'
(R):5'- CGCTGTGCTTTGAGATTTACTAC -3'

Sequencing Primer
(F):5'- ACGGGCTTCACCTTAACATACTG -3'
(R):5'- GTGCTTTGAGATTTACTACCTGTC -3'
Posted On2015-01-23