Incidental Mutation 'R3405:Lrrc30'
List |< first << previous [record 20 of 47] next >> last >|
ID259354
Institutional Source Beutler Lab
Gene Symbol Lrrc30
Ensembl Gene ENSMUSG00000073375
Gene Nameleucine rich repeat containing 30
SynonymsLOC240131
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location67630965-67632723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67632180 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 135 (L135P)
Ref Sequence ENSEMBL: ENSMUSP00000094893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097290]
Predicted Effect probably damaging
Transcript: ENSMUST00000097290
AA Change: L135P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094893
Gene: ENSMUSG00000073375
AA Change: L135P

DomainStartEndE-ValueType
LRR_TYP 69 92 1.67e-2 SMART
LRR 115 138 1.73e0 SMART
LRR 139 160 1.91e1 SMART
LRR_TYP 161 184 2.53e-2 SMART
Blast:LRR 207 229 1e-5 BLAST
LRR 230 253 3.29e-1 SMART
Meta Mutation Damage Score 0.7008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Lrrc30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Lrrc30 APN 17 67632039 missense probably damaging 1.00
IGL00957:Lrrc30 APN 17 67632504 missense probably benign 0.00
IGL02500:Lrrc30 APN 17 67631862 missense probably damaging 1.00
R1666:Lrrc30 UTSW 17 67632205 missense probably benign 0.39
R1769:Lrrc30 UTSW 17 67631681 makesense probably null
R2079:Lrrc30 UTSW 17 67631880 missense possibly damaging 0.80
R3406:Lrrc30 UTSW 17 67632180 missense probably damaging 1.00
R4301:Lrrc30 UTSW 17 67632568 missense probably damaging 1.00
R6399:Lrrc30 UTSW 17 67632686 start gained probably benign
R6469:Lrrc30 UTSW 17 67631865 missense probably benign
R7079:Lrrc30 UTSW 17 67632021 missense possibly damaging 0.96
R7454:Lrrc30 UTSW 17 67632243 missense probably damaging 0.97
R7611:Lrrc30 UTSW 17 67632429 missense probably damaging 0.97
R7642:Lrrc30 UTSW 17 67632477 missense probably damaging 1.00
X0027:Lrrc30 UTSW 17 67632459 missense probably damaging 1.00
Z1088:Lrrc30 UTSW 17 67631695 missense possibly damaging 0.93
Z1176:Lrrc30 UTSW 17 67632436 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTGCAGAAAGTCTAGCTCC -3'
(R):5'- ATGACAGACATCCCAGATTTTCTG -3'

Sequencing Primer
(F):5'- GTGCAGAAAGTCTAGCTCCTTCAG -3'
(R):5'- TGGAGGTCCAGAAACTCAATCTGTC -3'
Posted On2015-01-23