Incidental Mutation 'R3405:Myl12a'
List |< first << previous [record 28 of 47] next >> last >|
ID259355
Institutional Source Beutler Lab
Gene Symbol Myl12a
Ensembl Gene ENSMUSG00000024048
Gene Namemyosin, light chain 12A, regulatory, non-sarcomeric
Synonyms2900073G15Rik, brain specific myosin regulatory light chain, NMDA receptor-interacting protein
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R3405 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location70993656-71002878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70994742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 130 (M130K)
Ref Sequence ENSEMBL: ENSMUSP00000123412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024846] [ENSMUST00000038446] [ENSMUST00000123686] [ENSMUST00000128179] [ENSMUST00000148960] [ENSMUST00000150456]
Predicted Effect probably benign
Transcript: ENSMUST00000024846
AA Change: M130K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000024846
Gene: ENSMUSG00000024048
AA Change: M130K

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
EFh 33 61 2.52e-7 SMART
EFh 102 130 6.95e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038446
SMART Domains Protein: ENSMUSP00000042364
Gene: ENSMUSG00000034868

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
EFh 33 61 1.26e-7 SMART
EFh 102 130 1.25e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123686
AA Change: M130K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116398
Gene: ENSMUSG00000024048
AA Change: M130K

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
EFh 33 61 2.52e-7 SMART
EFh 102 130 6.95e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126529
Predicted Effect probably benign
Transcript: ENSMUST00000128179
SMART Domains Protein: ENSMUSP00000119491
Gene: ENSMUSG00000024048

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:EF-hand_1 33 58 7.7e-9 PFAM
Pfam:EF-hand_6 33 58 7.4e-9 PFAM
Pfam:EF-hand_5 34 58 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131820
Predicted Effect probably benign
Transcript: ENSMUST00000148960
AA Change: M130K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123412
Gene: ENSMUSG00000024048
AA Change: M130K

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
EFh 33 61 2.52e-7 SMART
EFh 102 130 6.95e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150456
SMART Domains Protein: ENSMUSP00000114712
Gene: ENSMUSG00000024048

DomainStartEndE-ValueType
Pfam:EF-hand_7 13 78 1.2e-8 PFAM
Pfam:EF-hand_1 33 61 1.7e-9 PFAM
Pfam:EF-hand_6 33 62 1.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.2933 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activity of nonmuscle myosin II (see MYH9; MIM 160775) is regulated by phosphorylation of a regulatory light chain, such as MRLC2. This phosphorylation results in higher MgATPase activity and the assembly of myosin II filaments (Iwasaki et al., 2001 [PubMed 11942626]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Myl12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Myl12a APN 17 70996853 missense probably benign 0.00
IGL01949:Myl12a APN 17 70996714 missense probably benign 0.18
IGL02136:Myl12a APN 17 70996856 nonsense probably null
R3406:Myl12a UTSW 17 70994742 missense probably benign 0.00
R3777:Myl12a UTSW 17 70994636 missense possibly damaging 0.93
R3779:Myl12a UTSW 17 70994636 missense possibly damaging 0.93
R4757:Myl12a UTSW 17 70996803 missense possibly damaging 0.86
R4798:Myl12a UTSW 17 70996302 intron probably benign
R5086:Myl12a UTSW 17 70994616 missense possibly damaging 0.70
R5419:Myl12a UTSW 17 70994699 missense probably benign 0.03
R7838:Myl12a UTSW 17 70996171 missense probably benign 0.02
R7921:Myl12a UTSW 17 70996171 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATACCCCAATGGCAACGGG -3'
(R):5'- TGCAAGGCACCTGTTGTATTGG -3'

Sequencing Primer
(F):5'- CCAATGGCAACGGGAGCAATG -3'
(R):5'- CTTGTGCTGATGAGCCACG -3'
Posted On2015-01-23