Incidental Mutation 'R3405:Bcorl1'
List |< first << previous [record 2 of 47] next >> last >|
ID259359
Institutional Source Beutler Lab
Gene Symbol Bcorl1
Ensembl Gene ENSMUSG00000036959
Gene NameBCL6 co-repressor-like 1
Synonyms6720425J07Rik
MMRRC Submission 040623-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R3405 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location48341358-48408049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48371007 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1139 (M1139K)
Ref Sequence ENSEMBL: ENSMUSP00000122000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037596] [ENSMUST00000136348] [ENSMUST00000156042]
Predicted Effect probably benign
Transcript: ENSMUST00000037596
AA Change: M1139K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000039898
Gene: ENSMUSG00000036959
AA Change: M1139K

DomainStartEndE-ValueType
low complexity region 205 218 N/A INTRINSIC
low complexity region 237 260 N/A INTRINSIC
low complexity region 268 301 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 368 410 N/A INTRINSIC
low complexity region 521 531 N/A INTRINSIC
low complexity region 1110 1138 N/A INTRINSIC
low complexity region 1248 1263 N/A INTRINSIC
low complexity region 1316 1324 N/A INTRINSIC
low complexity region 1328 1339 N/A INTRINSIC
ANK 1493 1523 3.44e1 SMART
ANK 1527 1556 7.02e-5 SMART
ANK 1560 1589 1.25e-1 SMART
Pfam:PUFD 1663 1780 3.7e-54 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114972
AA Change: M1124K
SMART Domains Protein: ENSMUSP00000110623
Gene: ENSMUSG00000036959
AA Change: M1124K

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
low complexity region 223 246 N/A INTRINSIC
low complexity region 254 287 N/A INTRINSIC
low complexity region 319 351 N/A INTRINSIC
low complexity region 354 396 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
low complexity region 1096 1124 N/A INTRINSIC
low complexity region 1234 1249 N/A INTRINSIC
low complexity region 1302 1310 N/A INTRINSIC
low complexity region 1314 1325 N/A INTRINSIC
ANK 1439 1468 7.02e-5 SMART
ANK 1472 1501 1.25e-1 SMART
Pfam:PUFD 1575 1692 1.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136348
AA Change: M1139K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122000
Gene: ENSMUSG00000036959
AA Change: M1139K

DomainStartEndE-ValueType
low complexity region 205 218 N/A INTRINSIC
low complexity region 237 260 N/A INTRINSIC
low complexity region 268 301 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 368 410 N/A INTRINSIC
low complexity region 521 531 N/A INTRINSIC
low complexity region 1110 1138 N/A INTRINSIC
low complexity region 1248 1263 N/A INTRINSIC
low complexity region 1316 1324 N/A INTRINSIC
low complexity region 1328 1339 N/A INTRINSIC
ANK 1493 1523 3.44e1 SMART
ANK 1527 1556 7.02e-5 SMART
ANK 1560 1589 1.25e-1 SMART
PDB:4HPM|C 1663 1781 1e-68 PDB
Predicted Effect unknown
Transcript: ENSMUST00000142160
AA Change: M580K
SMART Domains Protein: ENSMUSP00000117056
Gene: ENSMUSG00000036959
AA Change: M580K

DomainStartEndE-ValueType
SCOP:d1dcs__ 440 573 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156042
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional corepressor that is found tethered to promoter regions by DNA-binding proteins. The encoded protein can interact with several different class II histone deacetylases to repress transcription. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 C A 6: 85,667,963 probably benign Het
C2cd3 T C 7: 100,390,166 S191P probably benign Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Col3a1 G A 1: 45,338,753 probably benign Het
Cubn C T 2: 13,333,508 V2350I probably benign Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fancm T C 12: 65,075,772 S23P probably benign Het
Fmn1 A G 2: 113,364,348 E131G unknown Het
Gm5612 A T 9: 18,427,853 probably benign Het
Gsdma T C 11: 98,673,138 probably benign Het
Hormad2 T G 11: 4,424,302 Q88P probably damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Map3k4 A T 17: 12,256,781 F809Y probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Myrfl A G 10: 116,822,865 F396L probably damaging Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nlrp9c T A 7: 26,385,282 I291F probably benign Het
Nrp1 T A 8: 128,498,088 Y777* probably null Het
Ogdh T C 11: 6,349,462 V776A probably damaging Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Plg G T 17: 12,403,209 S472I possibly damaging Het
Pnlip A G 19: 58,680,759 T397A probably benign Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Szt2 A G 4: 118,394,020 V297A probably benign Het
Thada A T 17: 84,230,785 probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vwa8 T A 14: 79,164,220 probably benign Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Other mutations in Bcorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Bcorl1 APN X 48406042 missense probably damaging 1.00
IGL00491:Bcorl1 APN X 48406042 missense probably damaging 1.00
IGL00502:Bcorl1 APN X 48406042 missense probably damaging 1.00
IGL00504:Bcorl1 APN X 48406042 missense probably damaging 1.00
IGL00803:Bcorl1 APN X 48369552 missense probably damaging 1.00
IGL02227:Bcorl1 APN X 48369360 missense probably benign 0.04
R0696:Bcorl1 UTSW X 48406018 missense probably damaging 1.00
R1514:Bcorl1 UTSW X 48405944 missense probably damaging 1.00
R2069:Bcorl1 UTSW X 48401917 splice site probably benign
R2102:Bcorl1 UTSW X 48369204 missense probably benign 0.00
R2418:Bcorl1 UTSW X 48370541 missense probably damaging 1.00
R2419:Bcorl1 UTSW X 48370541 missense probably damaging 1.00
R3404:Bcorl1 UTSW X 48371007 missense probably benign 0.02
Z1176:Bcorl1 UTSW X 48367842 missense unknown
Z1176:Bcorl1 UTSW X 48375090 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGGCAAGCTCGAGTGAAAC -3'
(R):5'- GAATGAGCTAGGCCCTTTCCAG -3'

Sequencing Primer
(F):5'- CGGGAAAGCATTGGGGTCTTTAC -3'
(R):5'- AGGCCCTTTCCAGGTGAGAATATC -3'
Posted On2015-01-23