Incidental Mutation 'R0329:Iqca1l'
ID 25941
Institutional Source Beutler Lab
Gene Symbol Iqca1l
Ensembl Gene ENSMUSG00000038199
Gene Name IQ motif containing with AAA domain 1 like
Synonyms 4931409K22Rik
MMRRC Submission 038538-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R0329 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 24748432-24760467 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 24750783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088302] [ENSMUST00000117900] [ENSMUST00000200634]
AlphaFold A6H690
Predicted Effect possibly damaging
Transcript: ENSMUST00000088302
AA Change: N600S

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: N600S

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117900
SMART Domains Protein: ENSMUSP00000112743
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 100 129 2.62e-4 SMART
ANK 132 161 3.51e-5 SMART
ANK 165 194 7.99e2 SMART
ANK 199 228 1.44e-1 SMART
ANK 232 274 2.39e2 SMART
ANK 278 307 3.01e-4 SMART
ANK 311 347 1.46e2 SMART
SOCS_box 407 446 6.77e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199185
Predicted Effect probably benign
Transcript: ENSMUST00000200634
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Meta Mutation Damage Score 0.9203 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 99% (107/108)
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,349,430 (GRCm39) H3668L probably damaging Het
Acsbg3 A T 17: 57,190,631 (GRCm39) I400F probably benign Het
Acvr1c T C 2: 58,174,850 (GRCm39) T313A probably damaging Het
Adam28 T C 14: 68,855,188 (GRCm39) K651R probably damaging Het
Adamtsl3 A T 7: 82,171,198 (GRCm39) D417V probably damaging Het
Adgrf4 A T 17: 42,978,204 (GRCm39) C380S probably damaging Het
AI597479 T G 1: 43,150,277 (GRCm39) L129R probably benign Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Anxa7 A C 14: 20,519,566 (GRCm39) probably null Het
Arb2a T A 13: 77,910,070 (GRCm39) probably benign Het
Arhgap22 A G 14: 33,091,374 (GRCm39) R650G possibly damaging Het
Atp8a1 T A 5: 67,969,416 (GRCm39) probably benign Het
Bcr C T 10: 75,017,466 (GRCm39) T1209I possibly damaging Het
Bmpr1a C T 14: 34,151,734 (GRCm39) S185N probably benign Het
Calcoco1 A T 15: 102,624,198 (GRCm39) M246K probably benign Het
Casp12 T A 9: 5,345,534 (GRCm39) probably benign Het
Ccno T A 13: 113,126,530 (GRCm39) L333Q probably damaging Het
Cdhr2 T A 13: 54,882,614 (GRCm39) probably benign Het
Cftr T A 6: 18,226,096 (GRCm39) M318K probably null Het
Ckmt2 T A 13: 92,011,322 (GRCm39) D96V possibly damaging Het
Cnnm1 C T 19: 43,430,349 (GRCm39) P489L probably damaging Het
Cntnap1 A T 11: 101,079,135 (GRCm39) D1175V probably damaging Het
Cpne5 A T 17: 29,430,634 (GRCm39) L92H probably damaging Het
Crcp C A 5: 130,071,083 (GRCm39) Q61K possibly damaging Het
Crppa C T 12: 36,431,837 (GRCm39) A22V possibly damaging Het
Dcaf8 T A 1: 172,014,978 (GRCm39) D414E probably benign Het
Ddx28 T C 8: 106,736,877 (GRCm39) T394A probably benign Het
Ddx55 T C 5: 124,697,210 (GRCm39) F191L probably benign Het
Dnaaf1 T C 8: 120,322,756 (GRCm39) probably benign Het
Dnaaf2 C A 12: 69,244,518 (GRCm39) R181L probably damaging Het
Elac2 A G 11: 64,870,136 (GRCm39) Y67C probably damaging Het
Elf5 A G 2: 103,260,765 (GRCm39) probably benign Het
Emcn T A 3: 137,122,575 (GRCm39) probably benign Het
Erbb4 T C 1: 68,337,439 (GRCm39) probably benign Het
Erbin C A 13: 104,005,373 (GRCm39) C114F probably damaging Het
Etfdh T C 3: 79,517,151 (GRCm39) I353V probably benign Het
Fads2b T A 2: 85,348,895 (GRCm39) R72S probably benign Het
Fbxl12 C T 9: 20,549,776 (GRCm39) G316D probably damaging Het
Gbf1 G A 19: 46,260,709 (GRCm39) probably null Het
Gbp2b T G 3: 142,313,937 (GRCm39) S406A probably benign Het
Gli3 T G 13: 15,898,143 (GRCm39) L741R probably damaging Het
Gmip G T 8: 70,263,468 (GRCm39) S70I probably benign Het
Gnptab T C 10: 88,276,171 (GRCm39) S1153P probably damaging Het
Gp1ba A G 11: 70,531,235 (GRCm39) probably benign Het
Gramd1a T C 7: 30,837,679 (GRCm39) D360G possibly damaging Het
Hectd4 T C 5: 121,397,927 (GRCm39) I285T probably benign Het
Hrh4 A G 18: 13,140,302 (GRCm39) probably benign Het
Hsp90b1 T C 10: 86,530,019 (GRCm39) E226G probably damaging Het
Hspa13 A T 16: 75,562,018 (GRCm39) D60E probably damaging Het
Htt T A 5: 34,974,478 (GRCm39) probably benign Het
Kif14 G C 1: 136,423,764 (GRCm39) probably benign Het
Kit T G 5: 75,813,489 (GRCm39) V888G probably damaging Het
Lpin3 T C 2: 160,747,225 (GRCm39) V827A probably benign Het
Lrriq4 T C 3: 30,709,873 (GRCm39) S406P probably benign Het
Man2c1 T C 9: 57,048,467 (GRCm39) V777A probably benign Het
Mcm8 A G 2: 132,661,914 (GRCm39) K83E possibly damaging Het
Mep1a A G 17: 43,808,789 (GRCm39) probably null Het
Mtor T A 4: 148,568,837 (GRCm39) V1119E probably benign Het
Mybpc2 C T 7: 44,158,453 (GRCm39) A710T possibly damaging Het
Myo9a C G 9: 59,830,960 (GRCm39) T2368S probably damaging Het
Nbeal1 A G 1: 60,307,222 (GRCm39) Y1684C probably damaging Het
Npm3 A G 19: 45,737,965 (GRCm39) F11L probably benign Het
Nutf2 T A 8: 106,602,995 (GRCm39) S37T probably damaging Het
Obscn T A 11: 58,931,267 (GRCm39) I5790F probably damaging Het
Obscn A T 11: 58,943,332 (GRCm39) D4833E probably damaging Het
Or2g1 A T 17: 38,106,880 (GRCm39) M182L probably benign Het
Or7d9 T A 9: 20,197,153 (GRCm39) S61T possibly damaging Het
Or8g35 T C 9: 39,381,852 (GRCm39) T57A possibly damaging Het
Or9g4b T A 2: 85,616,147 (GRCm39) C97* probably null Het
Pcdhb1 A G 18: 37,400,077 (GRCm39) D676G possibly damaging Het
Pcif1 G T 2: 164,731,364 (GRCm39) R466L probably damaging Het
Pdk1 T C 2: 71,726,018 (GRCm39) probably benign Het
Phxr2 T C 10: 98,961,979 (GRCm39) probably benign Het
Pidd1 A T 7: 141,019,474 (GRCm39) probably benign Het
Plec A G 15: 76,075,618 (GRCm39) probably null Het
Polr1a T A 6: 71,943,400 (GRCm39) C1212S possibly damaging Het
Pot1a A G 6: 25,778,830 (GRCm39) probably benign Het
Prdm5 T C 6: 65,839,887 (GRCm39) probably benign Het
Primpol A T 8: 47,063,496 (GRCm39) N53K probably damaging Het
Pyroxd1 A G 6: 142,307,702 (GRCm39) I491V probably benign Het
Serpinb3b G T 1: 107,087,433 (GRCm39) N25K probably damaging Het
Slc9b1 C T 3: 135,078,996 (GRCm39) R218* probably null Het
Ssbp2 T A 13: 91,828,698 (GRCm39) probably null Het
Stat4 A G 1: 52,130,029 (GRCm39) probably benign Het
Steap4 T C 5: 8,025,829 (GRCm39) V130A possibly damaging Het
Stoml2 A G 4: 43,030,238 (GRCm39) probably null Het
Syne2 G T 12: 76,013,727 (GRCm39) G2974C probably benign Het
Tfdp2 T G 9: 96,188,946 (GRCm39) F200V probably damaging Het
Tgm4 T C 9: 122,877,622 (GRCm39) probably null Het
Tie1 C A 4: 118,341,924 (GRCm39) R175L probably benign Het
Tmem145 A G 7: 25,008,099 (GRCm39) probably benign Het
Tsacc A G 3: 88,190,169 (GRCm39) S94P possibly damaging Het
Tshz3 T A 7: 36,469,458 (GRCm39) D482E probably benign Het
Tspan33 T C 6: 29,711,091 (GRCm39) probably null Het
Ugt2b35 A G 5: 87,151,264 (GRCm39) K290R probably null Het
Unc80 T C 1: 66,713,246 (GRCm39) L2788P possibly damaging Het
Usp10 T A 8: 120,663,296 (GRCm39) C39* probably null Het
Utp20 T A 10: 88,653,841 (GRCm39) T260S probably benign Het
Vmn2r118 G T 17: 55,917,717 (GRCm39) T265K probably damaging Het
Vmn2r7 C A 3: 64,598,439 (GRCm39) C797F probably damaging Het
Vmn2r98 A C 17: 19,286,609 (GRCm39) H369P probably benign Het
Vps39 A T 2: 120,169,268 (GRCm39) Y245N possibly damaging Het
Wdr27 A G 17: 15,154,721 (GRCm39) probably benign Het
Ythdc2 A G 18: 44,998,127 (GRCm39) probably benign Het
Zcwpw2 C A 9: 117,843,123 (GRCm39) noncoding transcript Het
Zdhhc1 C A 8: 106,210,175 (GRCm39) A81S probably benign Het
Zfp729a G T 13: 67,768,473 (GRCm39) H585Q probably damaging Het
Other mutations in Iqca1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Iqca1l APN 5 24,753,292 (GRCm39) missense probably benign 0.03
IGL02110:Iqca1l APN 5 24,753,082 (GRCm39) splice site probably benign
R0492:Iqca1l UTSW 5 24,759,626 (GRCm39) missense probably damaging 1.00
R0585:Iqca1l UTSW 5 24,755,721 (GRCm39) missense probably benign
R0656:Iqca1l UTSW 5 24,754,760 (GRCm39) missense possibly damaging 0.67
R0894:Iqca1l UTSW 5 24,755,731 (GRCm39) splice site probably null
R1546:Iqca1l UTSW 5 24,760,426 (GRCm39) splice site probably null
R1642:Iqca1l UTSW 5 24,757,686 (GRCm39) missense probably damaging 1.00
R1998:Iqca1l UTSW 5 24,750,004 (GRCm39) missense probably benign 0.01
R2090:Iqca1l UTSW 5 24,755,674 (GRCm39) missense probably benign 0.15
R2186:Iqca1l UTSW 5 24,759,524 (GRCm39) missense probably damaging 1.00
R2237:Iqca1l UTSW 5 24,753,292 (GRCm39) missense probably benign 0.03
R2256:Iqca1l UTSW 5 24,757,038 (GRCm39) utr 3 prime probably benign
R2257:Iqca1l UTSW 5 24,757,038 (GRCm39) utr 3 prime probably benign
R3078:Iqca1l UTSW 5 24,751,664 (GRCm39) missense probably benign
R3522:Iqca1l UTSW 5 24,754,624 (GRCm39) critical splice donor site probably null
R3910:Iqca1l UTSW 5 24,750,440 (GRCm39) splice site probably benign
R3911:Iqca1l UTSW 5 24,750,440 (GRCm39) splice site probably benign
R4333:Iqca1l UTSW 5 24,749,368 (GRCm39) missense probably damaging 1.00
R4335:Iqca1l UTSW 5 24,749,368 (GRCm39) missense probably damaging 1.00
R4500:Iqca1l UTSW 5 24,753,275 (GRCm39) missense possibly damaging 0.85
R4761:Iqca1l UTSW 5 24,756,981 (GRCm39) missense probably benign
R4773:Iqca1l UTSW 5 24,755,596 (GRCm39) critical splice donor site probably null
R4880:Iqca1l UTSW 5 24,754,750 (GRCm39) missense probably benign
R5614:Iqca1l UTSW 5 24,755,140 (GRCm39) missense probably benign 0.03
R5839:Iqca1l UTSW 5 24,757,024 (GRCm39) missense probably damaging 0.98
R5847:Iqca1l UTSW 5 24,749,164 (GRCm39) missense probably benign 0.16
R7061:Iqca1l UTSW 5 24,750,063 (GRCm39) missense probably benign 0.00
R7131:Iqca1l UTSW 5 24,753,954 (GRCm39) missense possibly damaging 0.81
R7156:Iqca1l UTSW 5 24,757,648 (GRCm39) missense probably benign 0.05
R7248:Iqca1l UTSW 5 24,749,269 (GRCm39) missense probably benign 0.00
R7480:Iqca1l UTSW 5 24,751,904 (GRCm39) missense probably damaging 1.00
R7693:Iqca1l UTSW 5 24,751,626 (GRCm39) missense probably benign 0.01
R7782:Iqca1l UTSW 5 24,749,224 (GRCm39) missense probably damaging 0.98
R7814:Iqca1l UTSW 5 24,750,420 (GRCm39) missense possibly damaging 0.95
R7898:Iqca1l UTSW 5 24,758,643 (GRCm39) missense probably damaging 1.00
R8024:Iqca1l UTSW 5 24,755,634 (GRCm39) missense possibly damaging 0.70
R8172:Iqca1l UTSW 5 24,748,608 (GRCm39) missense probably benign
R8281:Iqca1l UTSW 5 24,754,008 (GRCm39) missense probably benign 0.02
R8511:Iqca1l UTSW 5 24,750,906 (GRCm39) missense possibly damaging 0.95
R8888:Iqca1l UTSW 5 24,755,628 (GRCm39) missense probably benign 0.20
R8895:Iqca1l UTSW 5 24,755,628 (GRCm39) missense probably benign 0.20
R9246:Iqca1l UTSW 5 24,753,969 (GRCm39) missense probably benign 0.22
R9450:Iqca1l UTSW 5 24,754,447 (GRCm39) missense probably benign 0.13
X0063:Iqca1l UTSW 5 24,754,763 (GRCm39) splice site probably null
Z1177:Iqca1l UTSW 5 24,755,793 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACCACAGAGCCCTTAGCTTCTAC -3'
(R):5'- GTGTCACATGCTTTTCAATGCCACC -3'

Sequencing Primer
(F):5'- CTCCCACAGGAGTTACTGGAAAG -3'
(R):5'- CCAAGAAGGTTGTTGATGCATACC -3'
Posted On 2013-04-16