Incidental Mutation 'R3708:Hspa4l'
ID 259426
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 040701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R3708 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40736125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 582 (N582I)
Ref Sequence ENSEMBL: ENSMUSP00000103721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably benign
Transcript: ENSMUST00000077083
AA Change: N603I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: N603I

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108086
AA Change: N582I

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: N582I

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect not run
Transcript: ENSMUST00000162743
AA Change: N111I
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably benign
Transcript: ENSMUST00000204702
AA Change: N603I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: N603I

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.1%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Abcc5 G T 16: 20,190,930 (GRCm39) Q807K probably benign Het
Amfr T C 8: 94,709,948 (GRCm39) H419R probably benign Het
Atp8b2 A T 3: 89,852,459 (GRCm39) F866I probably damaging Het
Atxn7l3 G A 11: 102,182,705 (GRCm39) probably benign Het
Bcs1l A G 1: 74,629,264 (GRCm39) probably benign Het
Card11 G A 5: 140,872,890 (GRCm39) R608C probably damaging Het
Celf2 C A 2: 6,629,489 (GRCm39) K137N probably damaging Het
Cmya5 A T 13: 93,231,874 (GRCm39) Y1071* probably null Het
Cyp2d10 A G 15: 82,287,217 (GRCm39) F469L possibly damaging Het
Cyp3a41a A G 5: 145,654,733 (GRCm39) probably null Het
Dnah8 A T 17: 30,958,631 (GRCm39) I2158L probably damaging Het
Dtnb T A 12: 3,639,156 (GRCm39) probably null Het
Dync1h1 T C 12: 110,609,563 (GRCm39) F2782L probably damaging Het
Ednrb A G 14: 104,054,516 (GRCm39) Y439H probably damaging Het
Ferd3l T C 12: 33,978,748 (GRCm39) V87A probably benign Het
Gphn T A 12: 78,579,467 (GRCm39) S320T probably benign Het
Gpr39 C T 1: 125,800,349 (GRCm39) H367Y probably damaging Het
Ighv1-85 A T 12: 115,963,836 (GRCm39) W55R probably damaging Het
Lelp1 A C 3: 92,042,714 (GRCm39) C112G unknown Het
Lrba A G 3: 86,192,331 (GRCm39) M82V possibly damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Map2 A T 1: 66,455,714 (GRCm39) probably benign Het
Ncor1 T C 11: 62,235,513 (GRCm39) K647R probably damaging Het
Nr4a3 A T 4: 48,056,699 (GRCm39) Y417F probably damaging Het
Nup50l G A 6: 96,142,933 (GRCm39) T37I possibly damaging Het
Obox7 C A 7: 14,398,122 (GRCm39) S54* probably null Het
Or2n1c A G 17: 38,519,174 (GRCm39) I13V probably benign Het
Or52r1c T G 7: 102,735,501 (GRCm39) Y254D probably damaging Het
Or8b101 T C 9: 38,020,740 (GRCm39) S253P probably damaging Het
Or9g20 T A 2: 85,630,342 (GRCm39) I91L probably benign Het
Pappa2 A T 1: 158,662,488 (GRCm39) Y1162* probably null Het
Pcdhb19 T A 18: 37,630,442 (GRCm39) I79K probably benign Het
Pi4k2a C T 19: 42,079,370 (GRCm39) Q144* probably null Het
Pigc T A 1: 161,798,663 (GRCm39) M215K probably benign Het
Pnma8a T A 7: 16,694,150 (GRCm39) S2T probably damaging Het
Ppfia4 T C 1: 134,237,398 (GRCm39) E967G probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rims3 A G 4: 120,740,352 (GRCm39) T100A probably damaging Het
Serpinb9 A T 13: 33,192,002 (GRCm39) N61I possibly damaging Het
Sis A G 3: 72,850,856 (GRCm39) M614T probably benign Het
Slc6a17 C T 3: 107,400,401 (GRCm39) V243I probably benign Het
Smad9 A T 3: 54,693,602 (GRCm39) Y177F probably benign Het
Vmn2r69 T C 7: 85,061,029 (GRCm39) D185G probably damaging Het
Vps36 G T 8: 22,682,899 (GRCm39) V5L probably benign Het
Vwa8 T A 14: 79,300,136 (GRCm39) probably benign Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACAGCAATAGGTTTGTTTGGC -3'
(R):5'- AGAGTTCGCTTCAGAAGGC -3'

Sequencing Primer
(F):5'- CAGCAATAGGTTTGTTTGGCTTTGC -3'
(R):5'- GCAAACCAGATTGCCTAGA -3'
Posted On 2015-01-23