Incidental Mutation 'R3708:Nr4a3'
ID259434
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission 040701-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3708 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48056699 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 417 (Y417F)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably damaging
Transcript: ENSMUST00000030025
AA Change: Y417F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: Y417F

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133539
Predicted Effect unknown
Transcript: ENSMUST00000153369
AA Change: Y446F
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: Y446F

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.1%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
1700123L14Rik G A 6: 96,165,952 T37I possibly damaging Het
Abcc5 G T 16: 20,372,180 Q807K probably benign Het
Amfr T C 8: 93,983,320 H419R probably benign Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn7l3 G A 11: 102,291,879 probably benign Het
Bcs1l A G 1: 74,590,105 probably benign Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Celf2 C A 2: 6,624,678 K137N probably damaging Het
Cmya5 A T 13: 93,095,366 Y1071* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Cyp3a41a A G 5: 145,717,923 probably null Het
Dnah8 A T 17: 30,739,657 I2158L probably damaging Het
Dtnb T A 12: 3,589,156 probably null Het
Dync1h1 T C 12: 110,643,129 F2782L probably damaging Het
Ednrb A G 14: 103,817,080 Y439H probably damaging Het
Ferd3l T C 12: 33,928,749 V87A probably benign Het
Gphn T A 12: 78,532,693 S320T probably benign Het
Gpr39 C T 1: 125,872,612 H367Y probably damaging Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Lrba A G 3: 86,285,024 M82V possibly damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Map2 A T 1: 66,416,555 probably benign Het
Ncor1 T C 11: 62,344,687 K647R probably damaging Het
Obox7 C A 7: 14,664,197 S54* probably null Het
Olfr1016 T A 2: 85,799,998 I91L probably benign Het
Olfr135 A G 17: 38,208,283 I13V probably benign Het
Olfr584 T G 7: 103,086,294 Y254D probably damaging Het
Olfr888 T C 9: 38,109,444 S253P probably damaging Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pcdhb19 T A 18: 37,497,389 I79K probably benign Het
Pi4k2a C T 19: 42,090,931 Q144* probably null Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pnmal1 T A 7: 16,960,225 S2T probably damaging Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims3 A G 4: 120,883,155 T100A probably damaging Het
Serpinb9 A T 13: 33,008,019 N61I possibly damaging Het
Sis A G 3: 72,943,523 M614T probably benign Het
Slc6a17 C T 3: 107,493,085 V243I probably benign Het
Smad9 A T 3: 54,786,181 Y177F probably benign Het
Vmn2r69 T C 7: 85,411,821 D185G probably damaging Het
Vps36 G T 8: 22,192,883 V5L probably benign Het
Vwa8 T A 14: 79,062,696 probably benign Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CTCATCAGTTGTGCGTACAGAC -3'
(R):5'- TGTAGCCCTGTCAGGATCAC -3'

Sequencing Primer
(F):5'- CAGTCTGAAAGGGAGGAGAGGTC -3'
(R):5'- AGCCCTGTCAGGATCACTTATTAAGC -3'
Posted On2015-01-23