Incidental Mutation 'R3708:Ednrb'
ID 259456
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 040701-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R3708 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104054516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 439 (Y439H)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: Y439H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: Y439H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: Y439H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: Y439H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227824
AA Change: Y439H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.1090 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.1%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Abcc5 G T 16: 20,190,930 (GRCm39) Q807K probably benign Het
Amfr T C 8: 94,709,948 (GRCm39) H419R probably benign Het
Atp8b2 A T 3: 89,852,459 (GRCm39) F866I probably damaging Het
Atxn7l3 G A 11: 102,182,705 (GRCm39) probably benign Het
Bcs1l A G 1: 74,629,264 (GRCm39) probably benign Het
Card11 G A 5: 140,872,890 (GRCm39) R608C probably damaging Het
Celf2 C A 2: 6,629,489 (GRCm39) K137N probably damaging Het
Cmya5 A T 13: 93,231,874 (GRCm39) Y1071* probably null Het
Cyp2d10 A G 15: 82,287,217 (GRCm39) F469L possibly damaging Het
Cyp3a41a A G 5: 145,654,733 (GRCm39) probably null Het
Dnah8 A T 17: 30,958,631 (GRCm39) I2158L probably damaging Het
Dtnb T A 12: 3,639,156 (GRCm39) probably null Het
Dync1h1 T C 12: 110,609,563 (GRCm39) F2782L probably damaging Het
Ferd3l T C 12: 33,978,748 (GRCm39) V87A probably benign Het
Gphn T A 12: 78,579,467 (GRCm39) S320T probably benign Het
Gpr39 C T 1: 125,800,349 (GRCm39) H367Y probably damaging Het
Hspa4l A T 3: 40,736,125 (GRCm39) N582I possibly damaging Het
Ighv1-85 A T 12: 115,963,836 (GRCm39) W55R probably damaging Het
Lelp1 A C 3: 92,042,714 (GRCm39) C112G unknown Het
Lrba A G 3: 86,192,331 (GRCm39) M82V possibly damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Map2 A T 1: 66,455,714 (GRCm39) probably benign Het
Ncor1 T C 11: 62,235,513 (GRCm39) K647R probably damaging Het
Nr4a3 A T 4: 48,056,699 (GRCm39) Y417F probably damaging Het
Nup50l G A 6: 96,142,933 (GRCm39) T37I possibly damaging Het
Obox7 C A 7: 14,398,122 (GRCm39) S54* probably null Het
Or2n1c A G 17: 38,519,174 (GRCm39) I13V probably benign Het
Or52r1c T G 7: 102,735,501 (GRCm39) Y254D probably damaging Het
Or8b101 T C 9: 38,020,740 (GRCm39) S253P probably damaging Het
Or9g20 T A 2: 85,630,342 (GRCm39) I91L probably benign Het
Pappa2 A T 1: 158,662,488 (GRCm39) Y1162* probably null Het
Pcdhb19 T A 18: 37,630,442 (GRCm39) I79K probably benign Het
Pi4k2a C T 19: 42,079,370 (GRCm39) Q144* probably null Het
Pigc T A 1: 161,798,663 (GRCm39) M215K probably benign Het
Pnma8a T A 7: 16,694,150 (GRCm39) S2T probably damaging Het
Ppfia4 T C 1: 134,237,398 (GRCm39) E967G probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rims3 A G 4: 120,740,352 (GRCm39) T100A probably damaging Het
Serpinb9 A T 13: 33,192,002 (GRCm39) N61I possibly damaging Het
Sis A G 3: 72,850,856 (GRCm39) M614T probably benign Het
Slc6a17 C T 3: 107,400,401 (GRCm39) V243I probably benign Het
Smad9 A T 3: 54,693,602 (GRCm39) Y177F probably benign Het
Vmn2r69 T C 7: 85,061,029 (GRCm39) D185G probably damaging Het
Vps36 G T 8: 22,682,899 (GRCm39) V5L probably benign Het
Vwa8 T A 14: 79,300,136 (GRCm39) probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TATATCCGGTGTTGAGCGTCAG -3'
(R):5'- CCCACACTTGCAAGGATAGTCAG -3'

Sequencing Primer
(F):5'- CGGTGTTGAGCGTCAGAACAG -3'
(R):5'- CTTGCAAGGATAGTCAGAGCCC -3'
Posted On 2015-01-23