Mutagenetix > Incidental Mutations

Incidental Mutation 'R3709:Cdc42bpa'

259470

Institutional Source

Beutler Lab

Gene Symbol

Cdc42bpa

Ensembl Gene

ENSMUSG00000026490

Gene Name

CDC42 binding protein kinase alpha

Synonyms

A930014J19Rik, DMPK-like

MMRRC Submission

040702-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.591) question?

Stock #

R3709 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

179960472-180165603 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 180065063 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 264 (D264G)

Ref Sequence

ENSEMBL: ENSMUSP00000148469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]

Predicted Effect

probably damaging
Transcript: ENSMUST00000076687
AA Change: D264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: D264G

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	588	N/A	INTRINSIC
coiled coil region	632	735	N/A	INTRINSIC
Pfam:DMPK_coil	800	860	2.7e-29	PFAM
C1	919	968	4.09e-7	SMART
PH	989	1109	6.02e-8	SMART
CNH	1134	1411	3.37e-17	SMART
low complexity region	1456	1468	N/A	INTRINSIC
PBD	1477	1512	2.05e-10	SMART
low complexity region	1531	1546	N/A	INTRINSIC
low complexity region	1567	1580	N/A	INTRINSIC
low complexity region	1606	1620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097450
AA Change: D264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: D264G

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.2e-29	PFAM
C1	1000	1049	4.09e-7	SMART
PH	1070	1190	6.02e-8	SMART
CNH	1215	1492	3.37e-17	SMART
low complexity region	1537	1549	N/A	INTRINSIC
PBD	1558	1593	2.05e-10	SMART
low complexity region	1612	1627	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
low complexity region	1687	1701	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097453
AA Change: D264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: D264G

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.5e-29	PFAM
C1	972	1021	4.09e-7	SMART
PH	1042	1162	6.02e-8	SMART
CNH	1187	1464	3.37e-17	SMART
low complexity region	1509	1521	N/A	INTRINSIC
PBD	1530	1565	2.05e-10	SMART
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1620	1633	N/A	INTRINSIC
low complexity region	1659	1673	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111117
AA Change: D264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: D264G

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
low complexity region	484	499	N/A	INTRINSIC
Pfam:KELK	529	608	1.1e-32	PFAM
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.6e-29	PFAM
C1	1013	1062	4.09e-7	SMART
PH	1083	1203	6.02e-8	SMART
CNH	1228	1505	3.37e-17	SMART
low complexity region	1550	1562	N/A	INTRINSIC
PBD	1571	1606	2.05e-10	SMART
low complexity region	1625	1640	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
low complexity region	1700	1714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134959

SMART Domains

Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

Domain	Start	End	E-Value	Type
PDB:4AW2\|A	2	90	1e-58	PDB
SCOP:d1koba_	50	90	7e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212756
AA Change: D264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9639

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	T	G	11: 49,019,653	D651A	probably damaging	Het
Abcb1a	A	G	5: 8,738,738	N1039S	probably benign	Het
Abcc2	G	T	19: 43,798,446	V169F	possibly damaging	Het
Adcy8	T	C	15: 64,725,535		probably benign	Het
Aida	C	A	1: 183,304,675		probably null	Het
Armc8	A	G	9: 99,520,497	I333T	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Ccdc92b	C	A	11: 74,638,107	R146S	probably damaging	Het
Cenpf	A	G	1: 189,648,812	S2804P	possibly damaging	Het
Cic	A	G	7: 25,286,981	D1276G	probably damaging	Het
Cldn19	T	C	4: 119,256,897	S79P	possibly damaging	Het
Ctdp1	G	A	18: 80,450,213	Q356*	probably null	Het
Cyp2c69	A	G	19: 39,851,223		probably benign	Het
D3Ertd254e	T	A	3: 36,159,576	C20S	possibly damaging	Het
Dhrs3	T	C	4: 144,893,711		probably null	Het
Fhod3	T	A	18: 25,090,758	W1054R	probably damaging	Het
Gfral	G	A	9: 76,193,443	R238*	probably null	Het
Gm10322	C	A	10: 59,616,119	D19E	possibly damaging	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Idh3a	T	C	9: 54,586,526	S4P	possibly damaging	Het
Il15ra	G	T	2: 11,730,647		probably null	Het
Ipo8	A	T	6: 148,806,344		probably null	Het
Iqgap1	G	A	7: 80,717,087	T1595I	possibly damaging	Het
Kalrn	C	T	16: 34,392,030		probably null	Het
Klrb1a	T	C	6: 128,618,503	D96G	probably benign	Het
Lrp1b	C	T	2: 40,697,442	V165M	unknown	Het
Lrp4	A	C	2: 91,490,466	T975P	possibly damaging	Het
Lsm14a	T	A	7: 34,353,779	I283F	probably damaging	Het
Mael	T	C	1: 166,238,566	D34G	probably damaging	Het
Map2	C	T	1: 66,415,856	Q1302*	probably null	Het
Mctp1	T	C	13: 76,824,880		probably null	Het
Mlxip	T	C	5: 123,447,474	V642A	probably benign	Het
Myh9	T	C	15: 77,773,347	E1066G	possibly damaging	Het
Naa35	T	A	13: 59,618,032		probably benign	Het
Nacc1	T	A	8: 84,677,199	I16F	probably damaging	Het
Ncapd3	T	A	9: 27,052,349	N499K	probably benign	Het
Olfr479	A	G	7: 108,055,797	M272V	possibly damaging	Het
Osbpl10	C	A	9: 115,207,587	P253Q	probably benign	Het
Ptpn21	G	T	12: 98,688,541	S722R	probably benign	Het
Rab44	C	T	17: 29,139,869	P344S	probably benign	Het
Rbms2	C	T	10: 128,143,443	R139Q	probably damaging	Het
Sh3bp2	T	C	5: 34,551,658	Y32H	probably damaging	Het
Slc6a15	A	G	10: 103,393,414	I105V	probably benign	Het
Thumpd3	A	G	6: 113,055,691	D130G	possibly damaging	Het
Trib1	A	G	15: 59,654,361	Y260C	probably damaging	Het
Tsks	G	T	7: 44,951,885	R208L	possibly damaging	Het
Ttn	G	T	2: 76,747,241	S22690*	probably null	Het
Ttyh2	T	G	11: 114,719,132	S510A	possibly damaging	Het
Was	G	T	X: 8,086,688	S271R	probably benign	Het
Zfp472	T	A	17: 32,977,711	Y253*	probably null	Het

Other mutations in Cdc42bpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Cdc42bpa	APN	1	180106121	missense	probably damaging	1.00
IGL00807:Cdc42bpa	APN	1	180141453	missense	possibly damaging	0.88
IGL00972:Cdc42bpa	APN	1	180074684	missense	probably benign	0.00
IGL01084:Cdc42bpa	APN	1	180142274	splice site	probably benign
IGL01149:Cdc42bpa	APN	1	180074572	missense	probably damaging	0.99
IGL01377:Cdc42bpa	APN	1	180065143	missense	probably damaging	1.00
IGL01541:Cdc42bpa	APN	1	180151158	critical splice acceptor site	probably null
IGL01657:Cdc42bpa	APN	1	180111866	missense	probably benign	0.05
IGL01720:Cdc42bpa	APN	1	180111282	missense	probably damaging	1.00
IGL02227:Cdc42bpa	APN	1	180094424	missense	possibly damaging	0.64
IGL02234:Cdc42bpa	APN	1	180151191	nonsense	probably null
IGL02253:Cdc42bpa	APN	1	180031596	splice site	probably benign
IGL02587:Cdc42bpa	APN	1	180093945	missense	possibly damaging	0.91
IGL02671:Cdc42bpa	APN	1	180061822	missense	probably benign
IGL02746:Cdc42bpa	APN	1	180111747	missense	possibly damaging	0.91
IGL02756:Cdc42bpa	APN	1	180109259	missense	possibly damaging	0.77
IGL02994:Cdc42bpa	APN	1	179999437	missense	probably damaging	1.00
IGL03073:Cdc42bpa	APN	1	180094376	splice site	probably benign
IGL03295:Cdc42bpa	APN	1	180150204	missense	probably benign	0.00
P0022:Cdc42bpa	UTSW	1	179961276	missense	probably damaging	0.99
PIT4142001:Cdc42bpa	UTSW	1	180031560	missense	probably damaging	1.00
R0125:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00
R0268:Cdc42bpa	UTSW	1	180155782	intron	probably benign
R0472:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0492:Cdc42bpa	UTSW	1	180101190	missense	probably benign	0.00
R0609:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0691:Cdc42bpa	UTSW	1	180144835	missense	possibly damaging	0.91
R0738:Cdc42bpa	UTSW	1	179999462	splice site	probably benign
R1547:Cdc42bpa	UTSW	1	180074644	missense	probably damaging	0.99
R1553:Cdc42bpa	UTSW	1	180093975	missense	probably benign	0.01
R1601:Cdc42bpa	UTSW	1	180065001	nonsense	probably null
R1709:Cdc42bpa	UTSW	1	180067224	missense	probably damaging	1.00
R2101:Cdc42bpa	UTSW	1	180146968	missense	probably benign	0.39
R2279:Cdc42bpa	UTSW	1	180036919	missense	probably damaging	0.99
R2357:Cdc42bpa	UTSW	1	180067227	missense	possibly damaging	0.81
R2373:Cdc42bpa	UTSW	1	180111784	missense	possibly damaging	0.78
R2570:Cdc42bpa	UTSW	1	180150177	missense	possibly damaging	0.84
R3710:Cdc42bpa	UTSW	1	180065063	missense	probably damaging	1.00
R3816:Cdc42bpa	UTSW	1	180144886	missense	possibly damaging	0.80
R3854:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3855:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3917:Cdc42bpa	UTSW	1	180106154	critical splice donor site	probably null
R4604:Cdc42bpa	UTSW	1	180109194	missense	probably benign	0.00
R4622:Cdc42bpa	UTSW	1	180074658	missense	probably damaging	0.98
R4664:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4665:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4887:Cdc42bpa	UTSW	1	180144635	missense	possibly damaging	0.61
R4989:Cdc42bpa	UTSW	1	180137801	missense	probably damaging	0.99
R5033:Cdc42bpa	UTSW	1	180065015	missense	probably damaging	1.00
R5050:Cdc42bpa	UTSW	1	180072453	nonsense	probably null
R5077:Cdc42bpa	UTSW	1	180094533	intron	probably benign
R5196:Cdc42bpa	UTSW	1	180072413	missense	probably benign	0.09
R5276:Cdc42bpa	UTSW	1	180137850	missense	probably damaging	1.00
R5313:Cdc42bpa	UTSW	1	180084433	missense	probably benign
R5364:Cdc42bpa	UTSW	1	180067182	missense	probably benign	0.06
R5372:Cdc42bpa	UTSW	1	180064979	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180067329	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180138520	missense	possibly damaging	0.95
R5646:Cdc42bpa	UTSW	1	180106094	missense	probably damaging	0.99
R5713:Cdc42bpa	UTSW	1	180084410	missense	probably benign	0.03
R6012:Cdc42bpa	UTSW	1	180065090	missense	probably damaging	1.00
R6029:Cdc42bpa	UTSW	1	180111787	missense	probably damaging	1.00
R6378:Cdc42bpa	UTSW	1	180093996	missense	possibly damaging	0.91
R6609:Cdc42bpa	UTSW	1	180101274	critical splice donor site	probably null
R7122:Cdc42bpa	UTSW	1	180065018	missense	probably damaging	1.00
R7289:Cdc42bpa	UTSW	1	180061797	nonsense	probably null
R7670:Cdc42bpa	UTSW	1	180065081	missense	probably damaging	1.00
X0026:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACGCCTACATACATACTGTATATCTC -3'
(R):5'- AGGAGCACTTCTCAACAAAATATAG -3'

Sequencing Primer
(F):5'- CTTTATTAGGTCCAGTCCTC -3'
(R):5'- AGAATGATTATCCCCTACTAATC -3'

Posted On

2015-01-23