Incidental Mutation 'R3709:Il15ra'
ID259473
Institutional Source Beutler Lab
Gene Symbol Il15ra
Ensembl Gene ENSMUSG00000023206
Gene Nameinterleukin 15 receptor, alpha chain
Synonyms
MMRRC Submission 040702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3709 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11705290-11734317 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 11730647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078834] [ENSMUST00000078834] [ENSMUST00000114831] [ENSMUST00000114831] [ENSMUST00000114832] [ENSMUST00000114832] [ENSMUST00000114833] [ENSMUST00000114833] [ENSMUST00000114834] [ENSMUST00000114834] [ENSMUST00000123600] [ENSMUST00000123600] [ENSMUST00000128156] [ENSMUST00000135341] [ENSMUST00000135341] [ENSMUST00000138349] [ENSMUST00000148748] [ENSMUST00000148748]
Predicted Effect probably null
Transcript: ENSMUST00000078834
SMART Domains Protein: ENSMUSP00000077878
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078834
SMART Domains Protein: ENSMUSP00000077878
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091456
Predicted Effect probably null
Transcript: ENSMUST00000114831
SMART Domains Protein: ENSMUSP00000110480
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114831
SMART Domains Protein: ENSMUSP00000110480
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114832
SMART Domains Protein: ENSMUSP00000110481
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114832
SMART Domains Protein: ENSMUSP00000110481
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114833
SMART Domains Protein: ENSMUSP00000110482
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114833
SMART Domains Protein: ENSMUSP00000110482
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114834
SMART Domains Protein: ENSMUSP00000110483
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114834
SMART Domains Protein: ENSMUSP00000110483
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123600
SMART Domains Protein: ENSMUSP00000130792
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123600
SMART Domains Protein: ENSMUSP00000130792
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126394
SMART Domains Protein: ENSMUSP00000131640
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128156
SMART Domains Protein: ENSMUSP00000126364
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135341
SMART Domains Protein: ENSMUSP00000132731
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135341
SMART Domains Protein: ENSMUSP00000132731
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138349
SMART Domains Protein: ENSMUSP00000131473
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139774
Predicted Effect probably null
Transcript: ENSMUST00000148748
SMART Domains Protein: ENSMUSP00000132058
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148748
SMART Domains Protein: ENSMUSP00000132058
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191662
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mutation of this gene results in absence of NK cell production in spleen and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T G 11: 49,019,653 D651A probably damaging Het
Abcb1a A G 5: 8,738,738 N1039S probably benign Het
Abcc2 G T 19: 43,798,446 V169F possibly damaging Het
Adcy8 T C 15: 64,725,535 probably benign Het
Aida C A 1: 183,304,675 probably null Het
Armc8 A G 9: 99,520,497 I333T probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc92b C A 11: 74,638,107 R146S probably damaging Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cenpf A G 1: 189,648,812 S2804P possibly damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Ctdp1 G A 18: 80,450,213 Q356* probably null Het
Cyp2c69 A G 19: 39,851,223 probably benign Het
D3Ertd254e T A 3: 36,159,576 C20S possibly damaging Het
Dhrs3 T C 4: 144,893,711 probably null Het
Fhod3 T A 18: 25,090,758 W1054R probably damaging Het
Gfral G A 9: 76,193,443 R238* probably null Het
Gm10322 C A 10: 59,616,119 D19E possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Idh3a T C 9: 54,586,526 S4P possibly damaging Het
Ipo8 A T 6: 148,806,344 probably null Het
Iqgap1 G A 7: 80,717,087 T1595I possibly damaging Het
Kalrn C T 16: 34,392,030 probably null Het
Klrb1a T C 6: 128,618,503 D96G probably benign Het
Lrp1b C T 2: 40,697,442 V165M unknown Het
Lrp4 A C 2: 91,490,466 T975P possibly damaging Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
Map2 C T 1: 66,415,856 Q1302* probably null Het
Mctp1 T C 13: 76,824,880 probably null Het
Mlxip T C 5: 123,447,474 V642A probably benign Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Naa35 T A 13: 59,618,032 probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Ncapd3 T A 9: 27,052,349 N499K probably benign Het
Olfr479 A G 7: 108,055,797 M272V possibly damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Ptpn21 G T 12: 98,688,541 S722R probably benign Het
Rab44 C T 17: 29,139,869 P344S probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Sh3bp2 T C 5: 34,551,658 Y32H probably damaging Het
Slc6a15 A G 10: 103,393,414 I105V probably benign Het
Thumpd3 A G 6: 113,055,691 D130G possibly damaging Het
Trib1 A G 15: 59,654,361 Y260C probably damaging Het
Tsks G T 7: 44,951,885 R208L possibly damaging Het
Ttn G T 2: 76,747,241 S22690* probably null Het
Ttyh2 T G 11: 114,719,132 S510A possibly damaging Het
Was G T X: 8,086,688 S271R probably benign Het
Zfp472 T A 17: 32,977,711 Y253* probably null Het
Other mutations in Il15ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Il15ra APN 2 11733145 splice site probably benign
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0945:Il15ra UTSW 2 11718327 missense probably damaging 0.96
R1863:Il15ra UTSW 2 11723436 missense possibly damaging 0.85
R1975:Il15ra UTSW 2 11723523 missense possibly damaging 0.94
R2172:Il15ra UTSW 2 11723571 missense possibly damaging 0.94
R2202:Il15ra UTSW 2 11718344 critical splice donor site probably null
R3710:Il15ra UTSW 2 11730647 critical splice donor site probably null
R4621:Il15ra UTSW 2 11718329 missense possibly damaging 0.95
R4701:Il15ra UTSW 2 11718345 splice site probably null
R4779:Il15ra UTSW 2 11718306 missense probably damaging 0.98
R4844:Il15ra UTSW 2 11718271 start gained probably benign
R5237:Il15ra UTSW 2 11733205 missense possibly damaging 0.91
R5810:Il15ra UTSW 2 11733252 unclassified probably null
R5880:Il15ra UTSW 2 11730615 makesense probably null
R6160:Il15ra UTSW 2 11720016 missense probably damaging 0.99
R7291:Il15ra UTSW 2 11718381 missense probably damaging 0.99
R7788:Il15ra UTSW 2 11723593 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGAAGAACATCCGTCCTGG -3'
(R):5'- TCAGTGCCTGCTGACATGTG -3'

Sequencing Primer
(F):5'- ACATCCGTCCTGGGCAAGAATG -3'
(R):5'- CCTGTGTGAGAAGTGGATAGCC -3'
Posted On2015-01-23