Mutagenetix > Incidental Mutations

Incidental Mutation 'R3709:Dhrs3'

259479

Institutional Source

Beutler Lab

Gene Symbol

Dhrs3

Ensembl Gene

ENSMUSG00000066026

Gene Name

dehydrogenase/reductase (SDR family) member 3

Synonyms

Rsdr1, retSDR1

MMRRC Submission

040702-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3709 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

144892827-144928209 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 144893711 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084184] [ENSMUST00000105744] [ENSMUST00000142808] [ENSMUST00000142808] [ENSMUST00000154208] [ENSMUST00000171001] [ENSMUST00000171001]

Predicted Effect

probably benign
Transcript: ENSMUST00000084184

SMART Domains

Protein: ENSMUSP00000081200
Gene: ENSMUSG00000066026

Domain	Start	End	E-Value	Type
Pfam:adh_short	39	121	1.7e-19	PFAM
Pfam:KR	40	119	1.5e-16	PFAM
Pfam:Polysacc_synt_2	41	121	1.3e-10	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105744

SMART Domains

Protein: ENSMUSP00000101370
Gene: ENSMUSG00000066026

Domain	Start	End	E-Value	Type
Pfam:adh_short	13	92	2.1e-18	PFAM
Pfam:KR	14	93	1.5e-15	PFAM
Pfam:Polysacc_synt_2	15	90	4.2e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128926

Predicted Effect

probably null
Transcript: ENSMUST00000142808

SMART Domains

Protein: ENSMUSP00000122578
Gene: ENSMUSG00000066026

Domain	Start	End	E-Value	Type
Pfam:adh_short	13	146	6.1e-29	PFAM
Pfam:KR	14	139	5.9e-20	PFAM
Pfam:Polysacc_synt_2	15	109	4.2e-10	PFAM
Pfam:Epimerase	15	124	3.8e-8	PFAM
Pfam:adh_short_C2	19	146	3.3e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000142808

SMART Domains

Protein: ENSMUSP00000122578
Gene: ENSMUSG00000066026

Domain	Start	End	E-Value	Type
Pfam:adh_short	13	146	6.1e-29	PFAM
Pfam:KR	14	139	5.9e-20	PFAM
Pfam:Polysacc_synt_2	15	109	4.2e-10	PFAM
Pfam:Epimerase	15	124	3.8e-8	PFAM
Pfam:adh_short_C2	19	146	3.3e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000154208

SMART Domains

Protein: ENSMUSP00000122552
Gene: ENSMUSG00000066026

Domain	Start	End	E-Value	Type
Pfam:adh_short	39	233	7.8e-42	PFAM
Pfam:KR	40	213	2.3e-21	PFAM
Pfam:Polysacc_synt_2	41	132	2.8e-9	PFAM
Pfam:adh_short_C2	45	205	4.8e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000171001

SMART Domains

Protein: ENSMUSP00000126154
Gene: ENSMUSG00000066026

Domain	Start	End	E-Value	Type
Pfam:adh_short	13	181	2.1e-34	PFAM
Pfam:KR	14	191	2.7e-21	PFAM
Pfam:Polysacc_synt_2	15	106	1.8e-9	PFAM
Pfam:Epimerase	15	124	2e-7	PFAM
Pfam:adh_short_C2	19	179	2e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000171001

SMART Domains

Protein: ENSMUSP00000126154
Gene: ENSMUSG00000066026

Domain	Start	End	E-Value	Type
Pfam:adh_short	13	181	2.1e-34	PFAM
Pfam:KR	14	191	2.7e-21	PFAM
Pfam:Polysacc_synt_2	15	106	1.8e-9	PFAM
Pfam:Epimerase	15	124	2e-7	PFAM
Pfam:adh_short_C2	19	179	2e-14	PFAM

Meta Mutation Damage Score

0.9591

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a targeted mutation die before weaning age. Mice homozygous for a gene trap allele exhibit perinatal lethality, altered retinoid metabolism and heart, craniofacial and skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	T	G	11: 49,019,653	D651A	probably damaging	Het
Abcb1a	A	G	5: 8,738,738	N1039S	probably benign	Het
Abcc2	G	T	19: 43,798,446	V169F	possibly damaging	Het
Adcy8	T	C	15: 64,725,535		probably benign	Het
Aida	C	A	1: 183,304,675		probably null	Het
Armc8	A	G	9: 99,520,497	I333T	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Ccdc92b	C	A	11: 74,638,107	R146S	probably damaging	Het
Cdc42bpa	A	G	1: 180,065,063	D264G	probably damaging	Het
Cenpf	A	G	1: 189,648,812	S2804P	possibly damaging	Het
Cic	A	G	7: 25,286,981	D1276G	probably damaging	Het
Cldn19	T	C	4: 119,256,897	S79P	possibly damaging	Het
Ctdp1	G	A	18: 80,450,213	Q356*	probably null	Het
Cyp2c69	A	G	19: 39,851,223		probably benign	Het
D3Ertd254e	T	A	3: 36,159,576	C20S	possibly damaging	Het
Fhod3	T	A	18: 25,090,758	W1054R	probably damaging	Het
Gfral	G	A	9: 76,193,443	R238*	probably null	Het
Gm10322	C	A	10: 59,616,119	D19E	possibly damaging	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Idh3a	T	C	9: 54,586,526	S4P	possibly damaging	Het
Il15ra	G	T	2: 11,730,647		probably null	Het
Ipo8	A	T	6: 148,806,344		probably null	Het
Iqgap1	G	A	7: 80,717,087	T1595I	possibly damaging	Het
Kalrn	C	T	16: 34,392,030		probably null	Het
Klrb1a	T	C	6: 128,618,503	D96G	probably benign	Het
Lrp1b	C	T	2: 40,697,442	V165M	unknown	Het
Lrp4	A	C	2: 91,490,466	T975P	possibly damaging	Het
Lsm14a	T	A	7: 34,353,779	I283F	probably damaging	Het
Mael	T	C	1: 166,238,566	D34G	probably damaging	Het
Map2	C	T	1: 66,415,856	Q1302*	probably null	Het
Mctp1	T	C	13: 76,824,880		probably null	Het
Mlxip	T	C	5: 123,447,474	V642A	probably benign	Het
Myh9	T	C	15: 77,773,347	E1066G	possibly damaging	Het
Naa35	T	A	13: 59,618,032		probably benign	Het
Nacc1	T	A	8: 84,677,199	I16F	probably damaging	Het
Ncapd3	T	A	9: 27,052,349	N499K	probably benign	Het
Olfr479	A	G	7: 108,055,797	M272V	possibly damaging	Het
Osbpl10	C	A	9: 115,207,587	P253Q	probably benign	Het
Ptpn21	G	T	12: 98,688,541	S722R	probably benign	Het
Rab44	C	T	17: 29,139,869	P344S	probably benign	Het
Rbms2	C	T	10: 128,143,443	R139Q	probably damaging	Het
Sh3bp2	T	C	5: 34,551,658	Y32H	probably damaging	Het
Slc6a15	A	G	10: 103,393,414	I105V	probably benign	Het
Thumpd3	A	G	6: 113,055,691	D130G	possibly damaging	Het
Trib1	A	G	15: 59,654,361	Y260C	probably damaging	Het
Tsks	G	T	7: 44,951,885	R208L	possibly damaging	Het
Ttn	G	T	2: 76,747,241	S22690*	probably null	Het
Ttyh2	T	G	11: 114,719,132	S510A	possibly damaging	Het
Was	G	T	X: 8,086,688	S271R	probably benign	Het
Zfp472	T	A	17: 32,977,711	Y253*	probably null	Het

Other mutations in Dhrs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01730:Dhrs3	APN	4	144919472	missense	probably damaging	0.96
IGL02226:Dhrs3	APN	4	144923949	missense	possibly damaging	0.94
IGL02236:Dhrs3	APN	4	144893563	missense	probably benign
IGL02728:Dhrs3	APN	4	144920072	missense	probably damaging	0.98
R0079:Dhrs3	UTSW	4	144920048	missense	probably damaging	0.99
R0734:Dhrs3	UTSW	4	144927176	missense	probably damaging	0.99
R1474:Dhrs3	UTSW	4	144919487	missense	probably damaging	1.00
R1632:Dhrs3	UTSW	4	144893546	missense	probably benign	0.30
R2010:Dhrs3	UTSW	4	144927188	missense	possibly damaging	0.49
R3162:Dhrs3	UTSW	4	144919446	missense	possibly damaging	0.80
R3162:Dhrs3	UTSW	4	144919446	missense	possibly damaging	0.80
R3176:Dhrs3	UTSW	4	144923940	missense	probably benign	0.00
R3276:Dhrs3	UTSW	4	144923940	missense	probably benign	0.00
R3440:Dhrs3	UTSW	4	144920058	missense	probably damaging	1.00
R3795:Dhrs3	UTSW	4	144919392	missense	probably damaging	0.99
R5571:Dhrs3	UTSW	4	144893564	missense	probably benign	0.34
R5943:Dhrs3	UTSW	4	144919976	missense	possibly damaging	0.88
R6457:Dhrs3	UTSW	4	144919952	missense	probably damaging	1.00
R7607:Dhrs3	UTSW	4	144923940	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGTAGTGTTCCCTCTGCAAATG -3'
(R):5'- TGCCAAAACACAGTCCGGTG -3'

Sequencing Primer
(F):5'- TTGGTAACCAAAGCAGCC -3'
(R):5'- GATGAAACCGACTTGCTTCG -3'

Posted On

2015-01-23