Mutagenetix > Incidental Mutations

Incidental Mutation 'R3709:Cic'

259486

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

040702-MU

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.933) question?

Stock #

R3709 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25286981 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1276 (D1276G)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]

Predicted Effect

probably benign
Transcript: ENSMUST00000005578
AA Change: D369G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: D369G

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163320
AA Change: D369G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: D369G

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164440

Predicted Effect

probably benign
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165239
AA Change: D369G

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: D369G

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167162

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168956

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: D1276G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: D1276G

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170500

Meta Mutation Damage Score

0.0716

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	T	G	11: 49,019,653	D651A	probably damaging	Het
Abcb1a	A	G	5: 8,738,738	N1039S	probably benign	Het
Abcc2	G	T	19: 43,798,446	V169F	possibly damaging	Het
Adcy8	T	C	15: 64,725,535		probably benign	Het
Aida	C	A	1: 183,304,675		probably null	Het
Armc8	A	G	9: 99,520,497	I333T	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Ccdc92b	C	A	11: 74,638,107	R146S	probably damaging	Het
Cdc42bpa	A	G	1: 180,065,063	D264G	probably damaging	Het
Cenpf	A	G	1: 189,648,812	S2804P	possibly damaging	Het
Cldn19	T	C	4: 119,256,897	S79P	possibly damaging	Het
Ctdp1	G	A	18: 80,450,213	Q356*	probably null	Het
Cyp2c69	A	G	19: 39,851,223		probably benign	Het
D3Ertd254e	T	A	3: 36,159,576	C20S	possibly damaging	Het
Dhrs3	T	C	4: 144,893,711		probably null	Het
Fhod3	T	A	18: 25,090,758	W1054R	probably damaging	Het
Gfral	G	A	9: 76,193,443	R238*	probably null	Het
Gm10322	C	A	10: 59,616,119	D19E	possibly damaging	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Idh3a	T	C	9: 54,586,526	S4P	possibly damaging	Het
Il15ra	G	T	2: 11,730,647		probably null	Het
Ipo8	A	T	6: 148,806,344		probably null	Het
Iqgap1	G	A	7: 80,717,087	T1595I	possibly damaging	Het
Kalrn	C	T	16: 34,392,030		probably null	Het
Klrb1a	T	C	6: 128,618,503	D96G	probably benign	Het
Lrp1b	C	T	2: 40,697,442	V165M	unknown	Het
Lrp4	A	C	2: 91,490,466	T975P	possibly damaging	Het
Lsm14a	T	A	7: 34,353,779	I283F	probably damaging	Het
Mael	T	C	1: 166,238,566	D34G	probably damaging	Het
Map2	C	T	1: 66,415,856	Q1302*	probably null	Het
Mctp1	T	C	13: 76,824,880		probably null	Het
Mlxip	T	C	5: 123,447,474	V642A	probably benign	Het
Myh9	T	C	15: 77,773,347	E1066G	possibly damaging	Het
Naa35	T	A	13: 59,618,032		probably benign	Het
Nacc1	T	A	8: 84,677,199	I16F	probably damaging	Het
Ncapd3	T	A	9: 27,052,349	N499K	probably benign	Het
Olfr479	A	G	7: 108,055,797	M272V	possibly damaging	Het
Osbpl10	C	A	9: 115,207,587	P253Q	probably benign	Het
Ptpn21	G	T	12: 98,688,541	S722R	probably benign	Het
Rab44	C	T	17: 29,139,869	P344S	probably benign	Het
Rbms2	C	T	10: 128,143,443	R139Q	probably damaging	Het
Sh3bp2	T	C	5: 34,551,658	Y32H	probably damaging	Het
Slc6a15	A	G	10: 103,393,414	I105V	probably benign	Het
Thumpd3	A	G	6: 113,055,691	D130G	possibly damaging	Het
Trib1	A	G	15: 59,654,361	Y260C	probably damaging	Het
Tsks	G	T	7: 44,951,885	R208L	possibly damaging	Het
Ttn	G	T	2: 76,747,241	S22690*	probably null	Het
Ttyh2	T	G	11: 114,719,132	S510A	possibly damaging	Het
Was	G	T	X: 8,086,688	S271R	probably benign	Het
Zfp472	T	A	17: 32,977,711	Y253*	probably null	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	unclassified	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7698:Cic	UTSW	7	25273172	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	25288782	missense	probably damaging	1.00
V7732:Cic	UTSW	7	25292245	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTCCTGACTGTTACAGCTTGG -3'
(R):5'- AGATCCTGGAGCACCATACTG -3'

Sequencing Primer
(F):5'- ACTGTTACAGCTTGGGCACC -3'
(R):5'- AGAAACCATCTGTGGGAC -3'

Posted On

2015-01-23