Incidental Mutation 'R3709:Olfr479'
ID259490
Institutional Source Beutler Lab
Gene Symbol Olfr479
Ensembl Gene ENSMUSG00000043855
Gene Nameolfactory receptor 479
SynonymsMOR267-15, GA_x6K02T2PBJ9-10384085-10385068
MMRRC Submission 040702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3709 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108050693-108056783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108055797 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 272 (M272V)
Ref Sequence ENSEMBL: ENSMUSP00000149060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063151] [ENSMUST00000209805] [ENSMUST00000214599]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063151
AA Change: M272V

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056631
Gene: ENSMUSG00000043855
AA Change: M272V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.5e-45 PFAM
Pfam:7tm_1 39 301 1.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209805
AA Change: M272V

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214599
AA Change: M272V

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T G 11: 49,019,653 D651A probably damaging Het
Abcb1a A G 5: 8,738,738 N1039S probably benign Het
Abcc2 G T 19: 43,798,446 V169F possibly damaging Het
Adcy8 T C 15: 64,725,535 probably benign Het
Aida C A 1: 183,304,675 probably null Het
Armc8 A G 9: 99,520,497 I333T probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc92b C A 11: 74,638,107 R146S probably damaging Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cenpf A G 1: 189,648,812 S2804P possibly damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Ctdp1 G A 18: 80,450,213 Q356* probably null Het
Cyp2c69 A G 19: 39,851,223 probably benign Het
D3Ertd254e T A 3: 36,159,576 C20S possibly damaging Het
Dhrs3 T C 4: 144,893,711 probably null Het
Fhod3 T A 18: 25,090,758 W1054R probably damaging Het
Gfral G A 9: 76,193,443 R238* probably null Het
Gm10322 C A 10: 59,616,119 D19E possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Idh3a T C 9: 54,586,526 S4P possibly damaging Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Iqgap1 G A 7: 80,717,087 T1595I possibly damaging Het
Kalrn C T 16: 34,392,030 probably null Het
Klrb1a T C 6: 128,618,503 D96G probably benign Het
Lrp1b C T 2: 40,697,442 V165M unknown Het
Lrp4 A C 2: 91,490,466 T975P possibly damaging Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
Map2 C T 1: 66,415,856 Q1302* probably null Het
Mctp1 T C 13: 76,824,880 probably null Het
Mlxip T C 5: 123,447,474 V642A probably benign Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Naa35 T A 13: 59,618,032 probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Ncapd3 T A 9: 27,052,349 N499K probably benign Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Ptpn21 G T 12: 98,688,541 S722R probably benign Het
Rab44 C T 17: 29,139,869 P344S probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Sh3bp2 T C 5: 34,551,658 Y32H probably damaging Het
Slc6a15 A G 10: 103,393,414 I105V probably benign Het
Thumpd3 A G 6: 113,055,691 D130G possibly damaging Het
Trib1 A G 15: 59,654,361 Y260C probably damaging Het
Tsks G T 7: 44,951,885 R208L possibly damaging Het
Ttn G T 2: 76,747,241 S22690* probably null Het
Ttyh2 T G 11: 114,719,132 S510A possibly damaging Het
Was G T X: 8,086,688 S271R probably benign Het
Zfp472 T A 17: 32,977,711 Y253* probably null Het
Other mutations in Olfr479
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Olfr479 APN 7 108055567 missense probably damaging 0.96
IGL01320:Olfr479 APN 7 108054981 utr 5 prime probably benign
IGL01322:Olfr479 APN 7 108054981 utr 5 prime probably benign
R0396:Olfr479 UTSW 7 108055963 missense probably benign 0.11
R0539:Olfr479 UTSW 7 108055822 missense probably damaging 1.00
R2129:Olfr479 UTSW 7 108055904 missense probably benign 0.25
R2246:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R2247:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3149:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3714:Olfr479 UTSW 7 108055435 missense probably damaging 0.99
R4326:Olfr479 UTSW 7 108055155 missense probably damaging 1.00
R4962:Olfr479 UTSW 7 108055440 missense probably benign 0.27
R5053:Olfr479 UTSW 7 108055534 missense probably benign 0.10
R5976:Olfr479 UTSW 7 108055798 missense possibly damaging 0.89
R6151:Olfr479 UTSW 7 108055899 missense probably benign
R6939:Olfr479 UTSW 7 108055105 missense possibly damaging 0.87
R7271:Olfr479 UTSW 7 108055216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGTGATTACACTGCTC -3'
(R):5'- CACTATTGTTGTCAGTGCTCAATAG -3'

Sequencing Primer
(F):5'- GTGATTACACTGCTCATCATGC -3'
(R):5'- TTGTCAGTGCTCAATAGTTGTTC -3'
Posted On2015-01-23