Mutagenetix > Incidental Mutations

Incidental Mutation 'R3709:Nacc1'

259492

Institutional Source

Beutler Lab

Gene Symbol

Nacc1

Ensembl Gene

ENSMUSG00000001910

Gene Name

nucleus accumbens associated 1, BEN and BTB (POZ) domain containing

Synonyms

Btbd14b, 2010001H03Rik, 4930511N13Rik, Nac1

MMRRC Submission

040702-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3709 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

84670483-84687862 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84677199 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 16 (I16F)

Ref Sequence

ENSEMBL: ENSMUSP00000001975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001975]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001975
AA Change: I16F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000001975
Gene: ENSMUSG00000001910
AA Change: I16F

Domain	Start	End	E-Value	Type
BTB	30	124	4.05e-25	SMART
low complexity region	135	146	N/A	INTRINSIC
low complexity region	224	235	N/A	INTRINSIC
low complexity region	252	264	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
BEN	382	457	6.4e-18	SMART

Meta Mutation Damage Score

0.3211

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ protein family. BTB/POZ proteins are involved in several cellular processes including proliferation, apoptosis and transcription regulation. The encoded protein is a transcriptional repressor that plays a role in stem cell self-renewal and pluripotency maintenance. The encoded protein also suppresses transcription of the candidate tumor suppressor Gadd45GIP1, and expression of this gene may play a role in the progression of multiple types of cancer. A pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cocaine and amphetamine. Mice homozygous for a different knock-out allele exhibit thoracic vertebral transformation and loss of the sixth lumbar vertebrae with decreaed rib number and reduced chondrocyte migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	T	G	11: 49,019,653	D651A	probably damaging	Het
Abcb1a	A	G	5: 8,738,738	N1039S	probably benign	Het
Abcc2	G	T	19: 43,798,446	V169F	possibly damaging	Het
Adcy8	T	C	15: 64,725,535		probably benign	Het
Aida	C	A	1: 183,304,675		probably null	Het
Armc8	A	G	9: 99,520,497	I333T	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Ccdc92b	C	A	11: 74,638,107	R146S	probably damaging	Het
Cdc42bpa	A	G	1: 180,065,063	D264G	probably damaging	Het
Cenpf	A	G	1: 189,648,812	S2804P	possibly damaging	Het
Cic	A	G	7: 25,286,981	D1276G	probably damaging	Het
Cldn19	T	C	4: 119,256,897	S79P	possibly damaging	Het
Ctdp1	G	A	18: 80,450,213	Q356*	probably null	Het
Cyp2c69	A	G	19: 39,851,223		probably benign	Het
D3Ertd254e	T	A	3: 36,159,576	C20S	possibly damaging	Het
Dhrs3	T	C	4: 144,893,711		probably null	Het
Fhod3	T	A	18: 25,090,758	W1054R	probably damaging	Het
Gfral	G	A	9: 76,193,443	R238*	probably null	Het
Gm10322	C	A	10: 59,616,119	D19E	possibly damaging	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Idh3a	T	C	9: 54,586,526	S4P	possibly damaging	Het
Il15ra	G	T	2: 11,730,647		probably null	Het
Ipo8	A	T	6: 148,806,344		probably null	Het
Iqgap1	G	A	7: 80,717,087	T1595I	possibly damaging	Het
Kalrn	C	T	16: 34,392,030		probably null	Het
Klrb1a	T	C	6: 128,618,503	D96G	probably benign	Het
Lrp1b	C	T	2: 40,697,442	V165M	unknown	Het
Lrp4	A	C	2: 91,490,466	T975P	possibly damaging	Het
Lsm14a	T	A	7: 34,353,779	I283F	probably damaging	Het
Mael	T	C	1: 166,238,566	D34G	probably damaging	Het
Map2	C	T	1: 66,415,856	Q1302*	probably null	Het
Mctp1	T	C	13: 76,824,880		probably null	Het
Mlxip	T	C	5: 123,447,474	V642A	probably benign	Het
Myh9	T	C	15: 77,773,347	E1066G	possibly damaging	Het
Naa35	T	A	13: 59,618,032		probably benign	Het
Ncapd3	T	A	9: 27,052,349	N499K	probably benign	Het
Olfr479	A	G	7: 108,055,797	M272V	possibly damaging	Het
Osbpl10	C	A	9: 115,207,587	P253Q	probably benign	Het
Ptpn21	G	T	12: 98,688,541	S722R	probably benign	Het
Rab44	C	T	17: 29,139,869	P344S	probably benign	Het
Rbms2	C	T	10: 128,143,443	R139Q	probably damaging	Het
Sh3bp2	T	C	5: 34,551,658	Y32H	probably damaging	Het
Slc6a15	A	G	10: 103,393,414	I105V	probably benign	Het
Thumpd3	A	G	6: 113,055,691	D130G	possibly damaging	Het
Trib1	A	G	15: 59,654,361	Y260C	probably damaging	Het
Tsks	G	T	7: 44,951,885	R208L	possibly damaging	Het
Ttn	G	T	2: 76,747,241	S22690*	probably null	Het
Ttyh2	T	G	11: 114,719,132	S510A	possibly damaging	Het
Was	G	T	X: 8,086,688	S271R	probably benign	Het
Zfp472	T	A	17: 32,977,711	Y253*	probably null	Het

Other mutations in Nacc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0052:Nacc1	UTSW	8	84676225	missense	probably benign	0.00
R0069:Nacc1	UTSW	8	84677199	missense	probably damaging	1.00
R0145:Nacc1	UTSW	8	84674875	splice site	probably benign
R0732:Nacc1	UTSW	8	84676201	missense	probably damaging	0.96
R1966:Nacc1	UTSW	8	84676381	missense	probably damaging	1.00
R2064:Nacc1	UTSW	8	84673118	missense	probably benign	0.18
R4409:Nacc1	UTSW	8	84673044	makesense	probably null
R5428:Nacc1	UTSW	8	84676154	missense	probably damaging	1.00
R6014:Nacc1	UTSW	8	84675071	missense	possibly damaging	0.93
R6341:Nacc1	UTSW	8	84674791	missense	probably benign	0.09
R6862:Nacc1	UTSW	8	84673215	missense	probably damaging	1.00
R7288:Nacc1	UTSW	8	84676545	missense	probably benign
R7594:Nacc1	UTSW	8	84675002	missense	probably damaging	0.99
RF002:Nacc1	UTSW	8	84676219	missense	possibly damaging	0.50
Z1088:Nacc1	UTSW	8	84673286	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAAATGTGAGGATCTGCTGG -3'
(R):5'- CGCAGATTTTACCATGTGGC -3'

Sequencing Primer
(F):5'- CTGGAATGACTGTGGCTGCAC -3'
(R):5'- GGCTGTTGTTTGTGACTCCCAC -3'

Posted On

2015-01-23