Incidental Mutation 'R3709:Gfral'
ID259495
Institutional Source Beutler Lab
Gene Symbol Gfral
Ensembl Gene ENSMUSG00000059383
Gene NameGDNF family receptor alpha like
SynonymsGRAL
MMRRC Submission 040702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3709 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76164102-76213657 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 76193443 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 238 (R238*)
Ref Sequence ENSEMBL: ENSMUSP00000074421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074880] [ENSMUST00000184693]
Predicted Effect probably null
Transcript: ENSMUST00000074880
AA Change: R238*
SMART Domains Protein: ENSMUSP00000074421
Gene: ENSMUSG00000059383
AA Change: R238*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
GDNF 220 316 3.15e-17 SMART
transmembrane domain 351 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184693
SMART Domains Protein: ENSMUSP00000139120
Gene: ENSMUSG00000059383

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased susceptibility to diet-induced obesity caused by overeating and reduced glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T G 11: 49,019,653 D651A probably damaging Het
Abcb1a A G 5: 8,738,738 N1039S probably benign Het
Abcc2 G T 19: 43,798,446 V169F possibly damaging Het
Adcy8 T C 15: 64,725,535 probably benign Het
Aida C A 1: 183,304,675 probably null Het
Armc8 A G 9: 99,520,497 I333T probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc92b C A 11: 74,638,107 R146S probably damaging Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cenpf A G 1: 189,648,812 S2804P possibly damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Ctdp1 G A 18: 80,450,213 Q356* probably null Het
Cyp2c69 A G 19: 39,851,223 probably benign Het
D3Ertd254e T A 3: 36,159,576 C20S possibly damaging Het
Dhrs3 T C 4: 144,893,711 probably null Het
Fhod3 T A 18: 25,090,758 W1054R probably damaging Het
Gm10322 C A 10: 59,616,119 D19E possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Idh3a T C 9: 54,586,526 S4P possibly damaging Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Iqgap1 G A 7: 80,717,087 T1595I possibly damaging Het
Kalrn C T 16: 34,392,030 probably null Het
Klrb1a T C 6: 128,618,503 D96G probably benign Het
Lrp1b C T 2: 40,697,442 V165M unknown Het
Lrp4 A C 2: 91,490,466 T975P possibly damaging Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
Map2 C T 1: 66,415,856 Q1302* probably null Het
Mctp1 T C 13: 76,824,880 probably null Het
Mlxip T C 5: 123,447,474 V642A probably benign Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Naa35 T A 13: 59,618,032 probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Ncapd3 T A 9: 27,052,349 N499K probably benign Het
Olfr479 A G 7: 108,055,797 M272V possibly damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Ptpn21 G T 12: 98,688,541 S722R probably benign Het
Rab44 C T 17: 29,139,869 P344S probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Sh3bp2 T C 5: 34,551,658 Y32H probably damaging Het
Slc6a15 A G 10: 103,393,414 I105V probably benign Het
Thumpd3 A G 6: 113,055,691 D130G possibly damaging Het
Trib1 A G 15: 59,654,361 Y260C probably damaging Het
Tsks G T 7: 44,951,885 R208L possibly damaging Het
Ttn G T 2: 76,747,241 S22690* probably null Het
Ttyh2 T G 11: 114,719,132 S510A possibly damaging Het
Was G T X: 8,086,688 S271R probably benign Het
Zfp472 T A 17: 32,977,711 Y253* probably null Het
Other mutations in Gfral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Gfral APN 9 76164825 nonsense probably null
IGL02383:Gfral APN 9 76197092 missense probably damaging 0.97
IGL02987:Gfral APN 9 76197301 missense possibly damaging 0.82
IGL03002:Gfral APN 9 76197238 missense possibly damaging 0.61
IGL03055:Gfral UTSW 9 76208549 missense probably benign 0.00
PIT4585001:Gfral UTSW 9 76197294 missense probably damaging 1.00
R0268:Gfral UTSW 9 76197101 missense probably damaging 1.00
R0547:Gfral UTSW 9 76208642 missense probably benign 0.16
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1275:Gfral UTSW 9 76197032 missense probably damaging 1.00
R1830:Gfral UTSW 9 76193203 missense probably benign 0.01
R2249:Gfral UTSW 9 76193349 missense probably damaging 1.00
R4712:Gfral UTSW 9 76193445 missense possibly damaging 0.71
R5567:Gfral UTSW 9 76208618 missense probably benign 0.00
R5568:Gfral UTSW 9 76164805 makesense probably null
R5719:Gfral UTSW 9 76197046 missense probably benign 0.02
R5789:Gfral UTSW 9 76197046 missense probably benign 0.02
R5791:Gfral UTSW 9 76197046 missense probably benign 0.02
R7110:Gfral UTSW 9 76164830 missense possibly damaging 0.84
R7549:Gfral UTSW 9 76198975 missense probably benign 0.14
R7782:Gfral UTSW 9 76193290 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CTGCAAGCACAGGGTACTTG -3'
(R):5'- CAGTCTCAGGAAAGGATAGTAACTTG -3'

Sequencing Primer
(F):5'- GTACTTGCAGGACTGTCCCAAAG -3'
(R):5'- GGATAGTAACTTGCACGTTTCACTC -3'
Posted On2015-01-23