Incidental Mutation 'R3709:Rbms2'
ID259502
Institutional Source Beutler Lab
Gene Symbol Rbms2
Ensembl Gene ENSMUSG00000040043
Gene NameRNA binding motif, single stranded interacting protein 2
SynonymsScr3, 2610315E04Rik
MMRRC Submission 040702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3709 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128131558-128180297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128143443 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 139 (R139Q)
Ref Sequence ENSEMBL: ENSMUSP00000096742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092033] [ENSMUST00000099139]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092033
AA Change: R167Q

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089664
Gene: ENSMUSG00000040043
AA Change: R167Q

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
RRM 59 127 3.35e-16 SMART
RRM 138 209 1.94e-12 SMART
low complexity region 347 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099139
AA Change: R139Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096742
Gene: ENSMUSG00000040043
AA Change: R139Q

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
RRM 31 99 3.35e-16 SMART
RRM 110 181 1.94e-12 SMART
low complexity region 319 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218884
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. The RBMS proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. This protein was isolated by phenotypic complementation of cdc2 and cdc13 mutants of yeast and is thought to suppress cdc2 and cdc13 mutants through the induction of translation of cdc2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T G 11: 49,019,653 D651A probably damaging Het
Abcb1a A G 5: 8,738,738 N1039S probably benign Het
Abcc2 G T 19: 43,798,446 V169F possibly damaging Het
Adcy8 T C 15: 64,725,535 probably benign Het
Aida C A 1: 183,304,675 probably null Het
Armc8 A G 9: 99,520,497 I333T probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc92b C A 11: 74,638,107 R146S probably damaging Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cenpf A G 1: 189,648,812 S2804P possibly damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Ctdp1 G A 18: 80,450,213 Q356* probably null Het
Cyp2c69 A G 19: 39,851,223 probably benign Het
D3Ertd254e T A 3: 36,159,576 C20S possibly damaging Het
Dhrs3 T C 4: 144,893,711 probably null Het
Fhod3 T A 18: 25,090,758 W1054R probably damaging Het
Gfral G A 9: 76,193,443 R238* probably null Het
Gm10322 C A 10: 59,616,119 D19E possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Idh3a T C 9: 54,586,526 S4P possibly damaging Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Iqgap1 G A 7: 80,717,087 T1595I possibly damaging Het
Kalrn C T 16: 34,392,030 probably null Het
Klrb1a T C 6: 128,618,503 D96G probably benign Het
Lrp1b C T 2: 40,697,442 V165M unknown Het
Lrp4 A C 2: 91,490,466 T975P possibly damaging Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
Map2 C T 1: 66,415,856 Q1302* probably null Het
Mctp1 T C 13: 76,824,880 probably null Het
Mlxip T C 5: 123,447,474 V642A probably benign Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Naa35 T A 13: 59,618,032 probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Ncapd3 T A 9: 27,052,349 N499K probably benign Het
Olfr479 A G 7: 108,055,797 M272V possibly damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Ptpn21 G T 12: 98,688,541 S722R probably benign Het
Rab44 C T 17: 29,139,869 P344S probably benign Het
Sh3bp2 T C 5: 34,551,658 Y32H probably damaging Het
Slc6a15 A G 10: 103,393,414 I105V probably benign Het
Thumpd3 A G 6: 113,055,691 D130G possibly damaging Het
Trib1 A G 15: 59,654,361 Y260C probably damaging Het
Tsks G T 7: 44,951,885 R208L possibly damaging Het
Ttn G T 2: 76,747,241 S22690* probably null Het
Ttyh2 T G 11: 114,719,132 S510A possibly damaging Het
Was G T X: 8,086,688 S271R probably benign Het
Zfp472 T A 17: 32,977,711 Y253* probably null Het
Other mutations in Rbms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02573:Rbms2 APN 10 128143440 missense probably damaging 1.00
IGL03331:Rbms2 APN 10 128133635 unclassified probably benign
R0143:Rbms2 UTSW 10 128137954 missense probably benign 0.17
R0458:Rbms2 UTSW 10 128151189 missense probably damaging 1.00
R0494:Rbms2 UTSW 10 128133670 missense probably benign 0.00
R1348:Rbms2 UTSW 10 128176345 splice site probably null
R1809:Rbms2 UTSW 10 128138186 missense possibly damaging 0.91
R2059:Rbms2 UTSW 10 128137518 missense probably benign 0.00
R3710:Rbms2 UTSW 10 128143443 missense probably damaging 1.00
R4001:Rbms2 UTSW 10 128151300 missense probably benign 0.03
R5316:Rbms2 UTSW 10 128145737 missense probably damaging 0.98
R5494:Rbms2 UTSW 10 128137691 missense probably damaging 0.98
R5895:Rbms2 UTSW 10 128145687 missense possibly damaging 0.95
R6306:Rbms2 UTSW 10 128151181 critical splice donor site probably null
R7779:Rbms2 UTSW 10 128143446 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGTTCAGGGGAAGGGCAC -3'
(R):5'- CAAATGTTATTCTGTGCATGAGGG -3'

Sequencing Primer
(F):5'- ACGCCTATGTGTCTATATGTGTATG -3'
(R):5'- ATTCTGTGCATGAGGGCTGAG -3'
Posted On2015-01-23