Incidental Mutation 'R3709:Zfp472'
ID259515
Institutional Source Beutler Lab
Gene Symbol Zfp472
Ensembl Gene ENSMUSG00000053600
Gene Namezinc finger protein 472
SynonymsKrim-1, Krim-1A, Krim-1B
MMRRC Submission 040702-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3709 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32965814-32979233 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32977711 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 253 (Y253*)
Ref Sequence ENSEMBL: ENSMUSP00000036514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039132]
Predicted Effect probably null
Transcript: ENSMUST00000039132
AA Change: Y253*
SMART Domains Protein: ENSMUSP00000036514
Gene: ENSMUSG00000053600
AA Change: Y253*

DomainStartEndE-ValueType
KRAB 10 62 4.36e-15 SMART
ZnF_C2H2 197 219 2.45e0 SMART
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.76e-1 SMART
ZnF_C2H2 281 303 3.58e-2 SMART
ZnF_C2H2 309 331 3.29e-1 SMART
ZnF_C2H2 337 359 6.08e0 SMART
ZnF_C2H2 365 387 2.32e-1 SMART
ZnF_C2H2 393 415 6.57e-1 SMART
ZnF_C2H2 421 443 1.5e-4 SMART
ZnF_C2H2 449 471 2.2e-2 SMART
ZnF_C2H2 477 499 1.01e-1 SMART
ZnF_C2H2 505 527 8.94e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T G 11: 49,019,653 D651A probably damaging Het
Abcb1a A G 5: 8,738,738 N1039S probably benign Het
Abcc2 G T 19: 43,798,446 V169F possibly damaging Het
Adcy8 T C 15: 64,725,535 probably benign Het
Aida C A 1: 183,304,675 probably null Het
Armc8 A G 9: 99,520,497 I333T probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc92b C A 11: 74,638,107 R146S probably damaging Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cenpf A G 1: 189,648,812 S2804P possibly damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Ctdp1 G A 18: 80,450,213 Q356* probably null Het
Cyp2c69 A G 19: 39,851,223 probably benign Het
D3Ertd254e T A 3: 36,159,576 C20S possibly damaging Het
Dhrs3 T C 4: 144,893,711 probably null Het
Fhod3 T A 18: 25,090,758 W1054R probably damaging Het
Gfral G A 9: 76,193,443 R238* probably null Het
Gm10322 C A 10: 59,616,119 D19E possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Idh3a T C 9: 54,586,526 S4P possibly damaging Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Iqgap1 G A 7: 80,717,087 T1595I possibly damaging Het
Kalrn C T 16: 34,392,030 probably null Het
Klrb1a T C 6: 128,618,503 D96G probably benign Het
Lrp1b C T 2: 40,697,442 V165M unknown Het
Lrp4 A C 2: 91,490,466 T975P possibly damaging Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
Map2 C T 1: 66,415,856 Q1302* probably null Het
Mctp1 T C 13: 76,824,880 probably null Het
Mlxip T C 5: 123,447,474 V642A probably benign Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Naa35 T A 13: 59,618,032 probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Ncapd3 T A 9: 27,052,349 N499K probably benign Het
Olfr479 A G 7: 108,055,797 M272V possibly damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Ptpn21 G T 12: 98,688,541 S722R probably benign Het
Rab44 C T 17: 29,139,869 P344S probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Sh3bp2 T C 5: 34,551,658 Y32H probably damaging Het
Slc6a15 A G 10: 103,393,414 I105V probably benign Het
Thumpd3 A G 6: 113,055,691 D130G possibly damaging Het
Trib1 A G 15: 59,654,361 Y260C probably damaging Het
Tsks G T 7: 44,951,885 R208L possibly damaging Het
Ttn G T 2: 76,747,241 S22690* probably null Het
Ttyh2 T G 11: 114,719,132 S510A possibly damaging Het
Was G T X: 8,086,688 S271R probably benign Het
Other mutations in Zfp472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp472 APN 17 32977524 missense possibly damaging 0.47
IGL03012:Zfp472 APN 17 32977571 missense probably benign 0.18
IGL03184:Zfp472 APN 17 32977416 nonsense probably null
IGL03223:Zfp472 APN 17 32977274 missense probably benign 0.03
R0421:Zfp472 UTSW 17 32975923 missense possibly damaging 0.71
R0463:Zfp472 UTSW 17 32975962 missense probably damaging 0.98
R0614:Zfp472 UTSW 17 32977934 missense possibly damaging 0.53
R1348:Zfp472 UTSW 17 32977820 missense probably benign 0.44
R1557:Zfp472 UTSW 17 32975926 missense probably benign 0.32
R1630:Zfp472 UTSW 17 32977978 nonsense probably null
R1725:Zfp472 UTSW 17 32977337 missense possibly damaging 0.53
R1856:Zfp472 UTSW 17 32965913 missense possibly damaging 0.53
R1964:Zfp472 UTSW 17 32977874 missense possibly damaging 0.79
R2115:Zfp472 UTSW 17 32978014 missense possibly damaging 0.73
R2249:Zfp472 UTSW 17 32978135 missense possibly damaging 0.87
R2252:Zfp472 UTSW 17 32976283 nonsense probably null
R4119:Zfp472 UTSW 17 32978215 nonsense probably null
R4406:Zfp472 UTSW 17 32978160 missense probably benign 0.01
R4485:Zfp472 UTSW 17 32977568 missense possibly damaging 0.96
R4650:Zfp472 UTSW 17 32977657 missense possibly damaging 0.86
R4820:Zfp472 UTSW 17 32977442 missense probably benign 0.01
R5369:Zfp472 UTSW 17 32977743 missense probably damaging 0.98
R5438:Zfp472 UTSW 17 32978219 missense probably damaging 0.96
R5529:Zfp472 UTSW 17 32978433 missense possibly damaging 0.92
R5950:Zfp472 UTSW 17 32977507 missense possibly damaging 0.53
R6158:Zfp472 UTSW 17 32978389 nonsense probably null
R7012:Zfp472 UTSW 17 32977246 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCGATCATGATTATGAGGGAGC -3'
(R):5'- AGCTTTTCCGCAATGCTTAC -3'

Sequencing Primer
(F):5'- CATGATTATGAGGGAGCTTACACTG -3'
(R):5'- TGCTTACACACAAAAGGTCTCTCTC -3'
Posted On2015-01-23