Incidental Mutation 'R3709:Cyp2c69'
ID259518
Institutional Source Beutler Lab
Gene Symbol Cyp2c69
Ensembl Gene ENSMUSG00000092008
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 69
SynonymsAI098658
MMRRC Submission 040702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3709 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39842660-39886769 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 39851223 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168838]
Predicted Effect probably benign
Transcript: ENSMUST00000168838
SMART Domains Protein: ENSMUSP00000132832
Gene: ENSMUSG00000092008

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 7e-152 PFAM
Meta Mutation Damage Score 0.1624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 T G 11: 49,019,653 D651A probably damaging Het
Abcb1a A G 5: 8,738,738 N1039S probably benign Het
Abcc2 G T 19: 43,798,446 V169F possibly damaging Het
Adcy8 T C 15: 64,725,535 probably benign Het
Aida C A 1: 183,304,675 probably null Het
Armc8 A G 9: 99,520,497 I333T probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc92b C A 11: 74,638,107 R146S probably damaging Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cenpf A G 1: 189,648,812 S2804P possibly damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Ctdp1 G A 18: 80,450,213 Q356* probably null Het
D3Ertd254e T A 3: 36,159,576 C20S possibly damaging Het
Dhrs3 T C 4: 144,893,711 probably null Het
Fhod3 T A 18: 25,090,758 W1054R probably damaging Het
Gfral G A 9: 76,193,443 R238* probably null Het
Gm10322 C A 10: 59,616,119 D19E possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Idh3a T C 9: 54,586,526 S4P possibly damaging Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Iqgap1 G A 7: 80,717,087 T1595I possibly damaging Het
Kalrn C T 16: 34,392,030 probably null Het
Klrb1a T C 6: 128,618,503 D96G probably benign Het
Lrp1b C T 2: 40,697,442 V165M unknown Het
Lrp4 A C 2: 91,490,466 T975P possibly damaging Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
Map2 C T 1: 66,415,856 Q1302* probably null Het
Mctp1 T C 13: 76,824,880 probably null Het
Mlxip T C 5: 123,447,474 V642A probably benign Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Naa35 T A 13: 59,618,032 probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Ncapd3 T A 9: 27,052,349 N499K probably benign Het
Olfr479 A G 7: 108,055,797 M272V possibly damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Ptpn21 G T 12: 98,688,541 S722R probably benign Het
Rab44 C T 17: 29,139,869 P344S probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Sh3bp2 T C 5: 34,551,658 Y32H probably damaging Het
Slc6a15 A G 10: 103,393,414 I105V probably benign Het
Thumpd3 A G 6: 113,055,691 D130G possibly damaging Het
Trib1 A G 15: 59,654,361 Y260C probably damaging Het
Tsks G T 7: 44,951,885 R208L possibly damaging Het
Ttn G T 2: 76,747,241 S22690* probably null Het
Ttyh2 T G 11: 114,719,132 S510A possibly damaging Het
Was G T X: 8,086,688 S271R probably benign Het
Zfp472 T A 17: 32,977,711 Y253* probably null Het
Other mutations in Cyp2c69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Cyp2c69 APN 19 39881249 splice site probably benign
IGL02127:Cyp2c69 APN 19 39851057 missense probably damaging 0.99
IGL02945:Cyp2c69 APN 19 39886647 missense possibly damaging 0.81
IGL03067:Cyp2c69 APN 19 39881093 missense probably benign 0.29
IGL03069:Cyp2c69 APN 19 39881093 missense probably benign 0.29
R0545:Cyp2c69 UTSW 19 39886661 missense probably damaging 1.00
R1276:Cyp2c69 UTSW 19 39876224 missense possibly damaging 0.47
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1534:Cyp2c69 UTSW 19 39851149 missense probably benign
R1549:Cyp2c69 UTSW 19 39842986 missense probably benign 0.11
R1703:Cyp2c69 UTSW 19 39876366 missense probably benign 0.10
R1752:Cyp2c69 UTSW 19 39881153 missense probably damaging 1.00
R1769:Cyp2c69 UTSW 19 39876371 missense probably benign 0.00
R1843:Cyp2c69 UTSW 19 39877528 missense probably benign 0.27
R1938:Cyp2c69 UTSW 19 39849366 missense probably damaging 0.97
R2100:Cyp2c69 UTSW 19 39886686 missense probably benign 0.11
R2366:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2367:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2440:Cyp2c69 UTSW 19 39876294 missense probably benign 0.17
R2931:Cyp2c69 UTSW 19 39849483 missense probably damaging 1.00
R3793:Cyp2c69 UTSW 19 39881156 missense probably benign 0.44
R3898:Cyp2c69 UTSW 19 39876390 missense probably benign 0.00
R4579:Cyp2c69 UTSW 19 39881186 missense possibly damaging 0.89
R4707:Cyp2c69 UTSW 19 39849408 missense probably benign 0.39
R4778:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4779:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4780:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4838:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4877:Cyp2c69 UTSW 19 39877612 missense probably damaging 1.00
R5488:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R5489:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R6083:Cyp2c69 UTSW 19 39849456 missense probably damaging 1.00
R6278:Cyp2c69 UTSW 19 39843063 nonsense probably null
R6415:Cyp2c69 UTSW 19 39842921 missense probably benign 0.44
R6732:Cyp2c69 UTSW 19 39881499 missense probably benign
R6858:Cyp2c69 UTSW 19 39877565 missense probably benign 0.19
R7023:Cyp2c69 UTSW 19 39877542 missense probably benign 0.43
R7227:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7228:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7260:Cyp2c69 UTSW 19 39842900 missense probably benign 0.00
R7262:Cyp2c69 UTSW 19 39886732 start gained probably benign
R7479:Cyp2c69 UTSW 19 39881557 missense probably benign 0.00
R7570:Cyp2c69 UTSW 19 39859898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTTAGTGTCACAGGTTACTTCATG -3'
(R):5'- TGGTGATGAATCTGACCACTG -3'

Sequencing Primer
(F):5'- GGTTACTTCATGCACCAAACTAG -3'
(R):5'- TCTGACCACTGATAGTTAAGATAGGG -3'
Posted On2015-01-23