Incidental Mutation 'R3710:Samd11'
ID259531
Institutional Source Beutler Lab
Gene Symbol Samd11
Ensembl Gene ENSMUSG00000096351
Gene Namesterile alpha motif domain containing 11
Synonymsmr-s
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3710 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156246966-156255657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156250495 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 109 (L109F)
Ref Sequence ENSEMBL: ENSMUSP00000136611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179543] [ENSMUST00000179886] [ENSMUST00000179919] [ENSMUST00000217934] [ENSMUST00000218788] [ENSMUST00000219393] [ENSMUST00000220228]
Predicted Effect probably benign
Transcript: ENSMUST00000179543
SMART Domains Protein: ENSMUSP00000137253
Gene: ENSMUSG00000095567

DomainStartEndE-ValueType
low complexity region 21 58 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 121 139 N/A INTRINSIC
Pfam:Noc2 331 626 1.8e-128 PFAM
low complexity region 651 675 N/A INTRINSIC
low complexity region 701 723 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179886
SMART Domains Protein: ENSMUSP00000137183
Gene: ENSMUSG00000095567

DomainStartEndE-ValueType
Pfam:Noc2 172 470 1.2e-117 PFAM
low complexity region 494 518 N/A INTRINSIC
low complexity region 544 566 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179919
AA Change: L109F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136611
Gene: ENSMUSG00000096351
AA Change: L109F

DomainStartEndE-ValueType
low complexity region 277 295 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
SAM 411 478 1.82e-6 SMART
low complexity region 486 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217800
Predicted Effect probably damaging
Transcript: ENSMUST00000217934
AA Change: L99F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218230
Predicted Effect probably damaging
Transcript: ENSMUST00000218788
AA Change: L99F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219310
Predicted Effect possibly damaging
Transcript: ENSMUST00000219393
AA Change: L99F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220030
Predicted Effect probably benign
Transcript: ENSMUST00000220228
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Samd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1921:Samd11 UTSW 4 156248709 missense probably damaging 1.00
R4169:Samd11 UTSW 4 156247746 missense probably damaging 1.00
R4249:Samd11 UTSW 4 156250486 missense probably damaging 1.00
R4586:Samd11 UTSW 4 156249432 missense probably damaging 1.00
R4735:Samd11 UTSW 4 156248773 missense probably benign
R4794:Samd11 UTSW 4 156249465 missense probably damaging 0.98
R6481:Samd11 UTSW 4 156249078 unclassified probably null
R6583:Samd11 UTSW 4 156248134 missense possibly damaging 0.93
R7165:Samd11 UTSW 4 156252290 missense probably benign
R7357:Samd11 UTSW 4 156255007 intron probably null
R7402:Samd11 UTSW 4 156248773 missense probably benign
R7426:Samd11 UTSW 4 156249400 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAAGAAAGAATTGGCCTTCTC -3'
(R):5'- TGCTGATCCTCTAGCCTGTG -3'

Sequencing Primer
(F):5'- TTGGCCTTCTCAAGTAACAAGC -3'
(R):5'- TGATCCTCTAGCCTGTGACACAAAAG -3'
Posted On2015-01-23