Incidental Mutation 'R3710:Ipo8'
ID259540
Institutional Source Beutler Lab
Gene Symbol Ipo8
Ensembl Gene ENSMUSG00000040029
Gene Nameimportin 8
SynonymsOM-1, Om1, C130009K11Rik, Ranbp8, 6230418K12Rik
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3710 (G1)
Quality Score212
Status Validated
Chromosome6
Chromosomal Location148770683-148831467 bp(-) (GRCm38)
Type of Mutationintron (41 bp from exon)
DNA Base Change (assembly) A to T at 148806344 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048418] [ENSMUST00000145960] [ENSMUST00000204936]
Predicted Effect probably null
Transcript: ENSMUST00000048418
SMART Domains Protein: ENSMUSP00000046759
Gene: ENSMUSG00000040029

DomainStartEndE-ValueType
IBN_N 22 102 1.59e-13 SMART
Pfam:Cse1 166 470 6.6e-11 PFAM
low complexity region 895 908 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145743
Predicted Effect probably benign
Transcript: ENSMUST00000145960
SMART Domains Protein: ENSMUSP00000117365
Gene: ENSMUSG00000040029

DomainStartEndE-ValueType
IBN_N 22 102 1.59e-13 SMART
low complexity region 176 190 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204936
Meta Mutation Damage Score 0.6084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and, along with RanGTP and RANBP1, inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Ipo8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ipo8 APN 6 148782786 missense possibly damaging 0.77
IGL01012:Ipo8 APN 6 148789063 splice site probably benign
IGL01124:Ipo8 APN 6 148777376 missense probably benign
IGL01978:Ipo8 APN 6 148777289 missense probably benign 0.25
IGL02111:Ipo8 APN 6 148799780 missense probably damaging 1.00
IGL02193:Ipo8 APN 6 148777284 missense probably damaging 0.96
IGL02589:Ipo8 APN 6 148809907 missense probably damaging 0.98
IGL02690:Ipo8 APN 6 148777363 missense probably benign
IGL02724:Ipo8 APN 6 148791481 nonsense probably null
IGL02935:Ipo8 APN 6 148789841 missense probably benign 0.03
IGL03027:Ipo8 APN 6 148777239 missense probably benign 0.01
IGL03065:Ipo8 APN 6 148784707 missense probably benign 0.44
IGL03338:Ipo8 APN 6 148800257 missense probably benign 0.01
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0088:Ipo8 UTSW 6 148801936 missense probably benign 0.27
R0373:Ipo8 UTSW 6 148775042 missense probably benign 0.00
R0539:Ipo8 UTSW 6 148818108 missense probably benign 0.00
R0565:Ipo8 UTSW 6 148786723 missense probably damaging 1.00
R0660:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0664:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0791:Ipo8 UTSW 6 148821727 missense possibly damaging 0.94
R0989:Ipo8 UTSW 6 148796682 missense probably benign 0.38
R1416:Ipo8 UTSW 6 148789093 missense probably benign
R1417:Ipo8 UTSW 6 148818052 missense probably benign 0.02
R1590:Ipo8 UTSW 6 148810665 splice site probably null
R1703:Ipo8 UTSW 6 148789892 missense probably benign 0.00
R1709:Ipo8 UTSW 6 148782728 missense probably benign
R2079:Ipo8 UTSW 6 148789162 missense probably damaging 1.00
R2338:Ipo8 UTSW 6 148789823 missense probably benign 0.00
R2359:Ipo8 UTSW 6 148816477 splice site probably benign
R2696:Ipo8 UTSW 6 148796741 missense probably benign 0.01
R3407:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3408:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3709:Ipo8 UTSW 6 148806344 intron probably null
R3945:Ipo8 UTSW 6 148818117 missense probably damaging 1.00
R4326:Ipo8 UTSW 6 148800164 unclassified probably benign
R4329:Ipo8 UTSW 6 148800164 unclassified probably benign
R6105:Ipo8 UTSW 6 148798670 missense probably damaging 1.00
R6148:Ipo8 UTSW 6 148799780 missense probably damaging 1.00
R6359:Ipo8 UTSW 6 148777250 missense probably benign 0.01
R6377:Ipo8 UTSW 6 148816497 nonsense probably null
R6724:Ipo8 UTSW 6 148809975 splice site probably null
R7283:Ipo8 UTSW 6 148824481 missense possibly damaging 0.86
R7436:Ipo8 UTSW 6 148789805 missense probably benign 0.13
R7445:Ipo8 UTSW 6 148789817 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGCTCCAACTTTGCAAGCC -3'
(R):5'- CTTGCATAGCCTGGTGTCTC -3'

Sequencing Primer
(F):5'- GCAAGCCCTTTATAATGTAAGGCTG -3'
(R):5'- GCATAGCCTGGTGTCTCTATAG -3'
Posted On2015-01-23