Mutagenetix > Incidental Mutation

Incidental Mutation 'R3710:Ap3b2'

259546

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

040703-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R3710 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 81473850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

probably benign
Transcript: ENSMUST00000082090

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125634

Predicted Effect

probably benign
Transcript: ENSMUST00000152355

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	C	15: 64,725,535		probably benign	Het
Agbl2	G	A	2: 90,805,808	D563N	probably benign	Het
Aida	C	A	1: 183,304,675		probably null	Het
Ank1	A	G	8: 23,087,079	D200G	probably damaging	Het
Ankrd28	A	G	14: 31,748,851		probably benign	Het
Atrnl1	C	A	19: 57,657,114	H469N	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bud23	A	C	5: 135,056,350	S41A	possibly damaging	Het
Car12	G	T	9: 66,750,978	A21S	probably damaging	Het
Cav3	T	A	6: 112,459,813	M1K	probably null	Het
Cdc42bpa	A	G	1: 180,065,063	D264G	probably damaging	Het
Cic	A	G	7: 25,286,981	D1276G	probably damaging	Het
Col2a1	A	G	15: 97,990,907		probably benign	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Csn3	C	A	5: 87,930,023	N129K	possibly damaging	Het
Diaph1	C	A	18: 37,845,484	G1209W	probably damaging	Het
Dsg2	A	G	18: 20,602,117	T1051A	probably damaging	Het
Gm1965	A	T	6: 89,145,425		noncoding transcript	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Gsto1	T	C	19: 47,859,532		probably null	Het
Il15ra	G	T	2: 11,730,647		probably null	Het
Ipo8	A	T	6: 148,806,344		probably null	Het
Lsm14a	T	A	7: 34,353,779	I283F	probably damaging	Het
Mael	T	C	1: 166,238,566	D34G	probably damaging	Het
March6	A	T	15: 31,509,826		probably benign	Het
Mtmr10	C	A	7: 64,326,685	A410D	possibly damaging	Het
Myh9	T	C	15: 77,773,347	E1066G	possibly damaging	Het
Nim1k	A	G	13: 119,712,099	S420P	probably benign	Het
Nlrp4c	T	A	7: 6,065,628	V176E	probably damaging	Het
Ogfod1	A	T	8: 94,057,752	K313*	probably null	Het
Olfr1434	T	G	19: 12,283,086	F13V	probably damaging	Het
Osbpl10	C	A	9: 115,207,587	P253Q	probably benign	Het
Otof	A	T	5: 30,385,266	M661K	probably benign	Het
Rbms2	C	T	10: 128,143,443	R139Q	probably damaging	Het
Rimbp2	G	A	5: 128,789,731	T508I	probably benign	Het
Ros1	A	T	10: 52,161,895	C393*	probably null	Het
Rps17	T	A	7: 81,344,924	T30S	probably benign	Het
Rps3	T	C	7: 99,479,419	K197R	probably benign	Het
Samd11	G	A	4: 156,250,495	L109F	probably damaging	Het
Smarca2	T	G	19: 26,668,890		probably benign	Het
Sprr2g	C	A	3: 92,374,729	P30Q	unknown	Het
Spz1	G	A	13: 92,575,123	Q282*	probably null	Het
Syne3	A	G	12: 104,943,438	L713P	possibly damaging	Het
Tgm1	C	A	14: 55,712,595		probably benign	Het
Tomm22	T	C	15: 79,671,218	F55L	probably damaging	Het
Tph2	T	A	10: 115,174,058	Y199F	probably benign	Het
Vmn2r108	A	T	17: 20,462,670	F757L	probably benign	Het
Vmn2r69	T	A	7: 85,406,393	T846S	probably benign	Het
Was	G	T	X: 8,086,688	S271R	probably benign	Het
Zc3hav1	A	C	6: 38,332,162	M575R	probably benign	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCAGAGATTAAGTCTTGGGG -3'
(R):5'- TCTAAGCATGTGCAGAGCTG -3'

Sequencing Primer
(F):5'- TGGGGAACTATGATGTCTCCAAACC -3'
(R):5'- AGAGCTGCCCTGAGTATTGC -3'

Posted On

2015-01-23