Incidental Mutation 'R3710:Gprc6a'
ID 259554
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 040703-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3710 (G1)
Quality Score 217
Status Validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CAAA to CA at 51491776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably null
Transcript: ENSMUST00000020062
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218684
Predicted Effect probably null
Transcript: ENSMUST00000219286
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,597,384 (GRCm39) probably benign Het
Agbl2 G A 2: 90,636,152 (GRCm39) D563N probably benign Het
Aida C A 1: 183,085,610 (GRCm39) probably null Het
Ank1 A G 8: 23,577,095 (GRCm39) D200G probably damaging Het
Ankrd28 A G 14: 31,470,808 (GRCm39) probably benign Het
Ap3b2 C T 7: 81,123,598 (GRCm39) probably benign Het
Atrnl1 C A 19: 57,645,546 (GRCm39) H469N probably damaging Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Bud23 A C 5: 135,085,204 (GRCm39) S41A possibly damaging Het
Car12 G T 9: 66,658,260 (GRCm39) A21S probably damaging Het
Cav3 T A 6: 112,436,774 (GRCm39) M1K probably null Het
Cdc42bpa A G 1: 179,892,628 (GRCm39) D264G probably damaging Het
Cic A G 7: 24,986,406 (GRCm39) D1276G probably damaging Het
Col2a1 A G 15: 97,888,788 (GRCm39) probably benign Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Csn3 C A 5: 88,077,882 (GRCm39) N129K possibly damaging Het
Diaph1 C A 18: 37,978,537 (GRCm39) G1209W probably damaging Het
Dsg2 A G 18: 20,735,174 (GRCm39) T1051A probably damaging Het
Gm1965 A T 6: 89,122,407 (GRCm39) noncoding transcript Het
Gsto1 T C 19: 47,847,971 (GRCm39) probably null Het
Il15ra G T 2: 11,735,458 (GRCm39) probably null Het
Ipo8 A T 6: 148,707,842 (GRCm39) probably null Het
Lsm14a T A 7: 34,053,204 (GRCm39) I283F probably damaging Het
Mael T C 1: 166,066,135 (GRCm39) D34G probably damaging Het
Marchf6 A T 15: 31,509,972 (GRCm39) probably benign Het
Mtmr10 C A 7: 63,976,433 (GRCm39) A410D possibly damaging Het
Myh9 T C 15: 77,657,547 (GRCm39) E1066G possibly damaging Het
Nim1k A G 13: 120,173,635 (GRCm39) S420P probably benign Het
Nlrp4c T A 7: 6,068,627 (GRCm39) V176E probably damaging Het
Ogfod1 A T 8: 94,784,380 (GRCm39) K313* probably null Het
Or5an1 T G 19: 12,260,450 (GRCm39) F13V probably damaging Het
Osbpl10 C A 9: 115,036,655 (GRCm39) P253Q probably benign Het
Otof A T 5: 30,542,610 (GRCm39) M661K probably benign Het
Rbms2 C T 10: 127,979,312 (GRCm39) R139Q probably damaging Het
Rimbp2 G A 5: 128,866,795 (GRCm39) T508I probably benign Het
Ros1 A T 10: 52,037,991 (GRCm39) C393* probably null Het
Rps17 T A 7: 80,994,672 (GRCm39) T30S probably benign Het
Rps3 T C 7: 99,128,626 (GRCm39) K197R probably benign Het
Samd11 G A 4: 156,334,952 (GRCm39) L109F probably damaging Het
Smarca2 T G 19: 26,646,290 (GRCm39) probably benign Het
Sprr2g C A 3: 92,282,036 (GRCm39) P30Q unknown Het
Spz1 G A 13: 92,711,631 (GRCm39) Q282* probably null Het
Syne3 A G 12: 104,909,697 (GRCm39) L713P possibly damaging Het
Tgm1 C A 14: 55,950,052 (GRCm39) probably benign Het
Tomm22 T C 15: 79,555,419 (GRCm39) F55L probably damaging Het
Tph2 T A 10: 115,009,963 (GRCm39) Y199F probably benign Het
Vmn2r108 A T 17: 20,682,932 (GRCm39) F757L probably benign Het
Vmn2r69 T A 7: 85,055,601 (GRCm39) T846S probably benign Het
Was G T X: 7,952,927 (GRCm39) S271R probably benign Het
Zc3hav1 A C 6: 38,309,097 (GRCm39) M575R probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACCACTTGAATGCCCGTG -3'
(R):5'- GAGTATCTGGACTGGGATGACTCC -3'

Sequencing Primer
(F):5'- TGCCCGTGCAGGTAAGAAC -3'
(R):5'- ACTGGGATGACTCCTTGGCTC -3'
Posted On 2015-01-23