Incidental Mutation 'R3710:Ros1'
ID259555
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3710 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 52161895 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 393 (C393*)
Ref Sequence ENSEMBL: ENSMUSP00000151932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably null
Transcript: ENSMUST00000020045
AA Change: C402*
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: C402*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117992
AA Change: C402*
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: C402*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175892
AA Change: C393*
SMART Domains Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893
AA Change: C393*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 100 178 1.05e-4 SMART
FN3 196 273 7.45e-10 SMART
Blast:LY 360 400 1e-20 BLAST
Blast:LY 449 486 4e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000177378
AA Change: C402*
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: C402*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218452
AA Change: C402*
Predicted Effect probably null
Transcript: ENSMUST00000219173
AA Change: C402*
Predicted Effect probably null
Transcript: ENSMUST00000219692
AA Change: C393*
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
boss UTSW 10 52090995 nonsense probably null
Chuckwagon UTSW 10 52118203 missense probably damaging 1.00
trail UTSW 10 52161895 nonsense probably null
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 splice site probably null
R3424:Ros1 UTSW 10 52128416 splice site probably null
R3425:Ros1 UTSW 10 52128416 splice site probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
R7355:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R7385:Ros1 UTSW 10 52155126 missense probably benign 0.00
R7460:Ros1 UTSW 10 52118203 missense probably damaging 1.00
R7549:Ros1 UTSW 10 52145834 missense probably damaging 0.96
R7573:Ros1 UTSW 10 52169976 missense probably benign 0.03
R7650:Ros1 UTSW 10 52046209 missense probably benign 0.00
R7667:Ros1 UTSW 10 52163971 missense probably damaging 1.00
R7696:Ros1 UTSW 10 52142283 missense probably damaging 1.00
R7785:Ros1 UTSW 10 52162848 missense probably damaging 1.00
R7814:Ros1 UTSW 10 52096137 missense probably benign 0.28
R7830:Ros1 UTSW 10 52154934 missense probably damaging 0.99
R7832:Ros1 UTSW 10 52144861 missense probably damaging 0.99
R7854:Ros1 UTSW 10 52128467 missense probably damaging 1.00
R7912:Ros1 UTSW 10 52168695 missense probably damaging 1.00
R7972:Ros1 UTSW 10 52154830 nonsense probably null
R7993:Ros1 UTSW 10 52123347 missense probably benign 0.34
R8036:Ros1 UTSW 10 52165343 missense probably benign
R8137:Ros1 UTSW 10 52125837 missense possibly damaging 0.87
R8169:Ros1 UTSW 10 52064672 critical splice donor site probably null
R8199:Ros1 UTSW 10 52101717 nonsense probably null
R8293:Ros1 UTSW 10 52087918 missense probably damaging 1.00
R8368:Ros1 UTSW 10 52064737 missense probably damaging 1.00
R8406:Ros1 UTSW 10 52101845 missense possibly damaging 0.56
RF018:Ros1 UTSW 10 52155121 missense probably benign
Z1176:Ros1 UTSW 10 52091109 missense possibly damaging 0.89
Z1177:Ros1 UTSW 10 52168671 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTGATACAGTGTTCTGATCAC -3'
(R):5'- ACCTGAAGTCCAGAAGCTTGTAG -3'

Sequencing Primer
(F):5'- GTGTTCTGATCACAAGAGAGATCCC -3'
(R):5'- CAGCTTTGGGATTACAGCTATGCAC -3'
Posted On2015-01-23