Incidental Mutation 'R3710:Vmn2r108'
ID259568
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Namevomeronasal 2, receptor 108
SynonymsEG627805
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3710 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20462373-20481236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20462670 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 757 (F757L)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: F757L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: F757L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1411:Vmn2r108 UTSW 17 20462845 missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20471403 missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20471318 missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20481140 missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6364:Vmn2r108 UTSW 17 20470998 missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R6541:Vmn2r108 UTSW 17 20481218 missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATAGAGAAGACTTCCACAGCC -3'
(R):5'- GCCACTTTTCCAGGGAGAATGG -3'

Sequencing Primer
(F):5'- AGCCACCATGACCTTCCCTTTAG -3'
(R):5'- GTGGTTAATGACATCAAGAGCTCC -3'
Posted On2015-01-23