Incidental Mutation 'R3710:Olfr1434'
ID 259572
Institutional Source Beutler Lab
Gene Symbol Olfr1434
Ensembl Gene ENSMUSG00000095640
Gene Name olfactory receptor 1434
Synonyms MOR214-4, Olfr1433, MOR214-4, GA_x6K02T2RE5P-2618516-2619454, GA_x6K02T2RE5P-2610001-2610414
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R3710 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12279854-12285626 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12283086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 13 (F13V)
Ref Sequence ENSEMBL: ENSMUSP00000147137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207186] [ENSMUST00000207915] [ENSMUST00000208197]
AlphaFold Q7TQR9
Predicted Effect probably damaging
Transcript: ENSMUST00000087814
AA Change: F13V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085115
Gene: ENSMUSG00000095640
AA Change: F13V

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 9.2e-55 PFAM
Pfam:7tm_1 42 307 2.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207186
AA Change: F13V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207915
AA Change: F13V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208197
AA Change: F13V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8011 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Olfr1434
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Olfr1434 APN 19 12283705 missense probably damaging 1.00
IGL02415:Olfr1434 APN 19 12283498 missense probably benign 0.44
IGL02731:Olfr1434 APN 19 12283842 missense probably damaging 0.99
IGL02803:Olfr1434 APN 19 12283983 missense possibly damaging 0.94
IGL03050:Olfr1434 UTSW 19 12283512 missense probably benign
R0432:Olfr1434 UTSW 19 12283903 missense probably damaging 1.00
R2209:Olfr1434 UTSW 19 12283860 missense probably benign 0.41
R4724:Olfr1434 UTSW 19 12283096 missense probably damaging 1.00
R5133:Olfr1434 UTSW 19 12283306 missense possibly damaging 0.96
R5974:Olfr1434 UTSW 19 12283836 missense probably damaging 1.00
R6544:Olfr1434 UTSW 19 12283155 missense probably damaging 1.00
R7225:Olfr1434 UTSW 19 12283467 missense probably benign 0.00
R7320:Olfr1434 UTSW 19 12283816 missense possibly damaging 0.72
R7467:Olfr1434 UTSW 19 12283475 nonsense probably null
R7900:Olfr1434 UTSW 19 12283341 missense probably damaging 1.00
R8719:Olfr1434 UTSW 19 12283428 missense probably benign 0.13
R9135:Olfr1434 UTSW 19 12283444 missense probably damaging 1.00
R9324:Olfr1434 UTSW 19 12283575 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GTGTGATCACATTATTTCTTAGGCA -3'
(R):5'- GGTTGGAAAGCATCTTTGGGAC -3'

Sequencing Primer
(F):5'- TTAGGCATTGTATTCAAGAAGTAGTC -3'
(R):5'- AGCATCTTTGGGACTGTAGAAG -3'
Posted On 2015-01-23