Mutagenetix > Incidental Mutations

Incidental Mutation 'R3710:Atrnl1'

259575

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

MMRRC Submission

040703-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R3710 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 57657114 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 469 (H469N)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077282
AA Change: H469N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: H469N

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Meta Mutation Damage Score

0.4531

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (55/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	C	15: 64,725,535		probably benign	Het
Agbl2	G	A	2: 90,805,808	D563N	probably benign	Het
Aida	C	A	1: 183,304,675		probably null	Het
Ank1	A	G	8: 23,087,079	D200G	probably damaging	Het
Ankrd28	A	G	14: 31,748,851		probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bud23	A	C	5: 135,056,350	S41A	possibly damaging	Het
Car12	G	T	9: 66,750,978	A21S	probably damaging	Het
Cav3	T	A	6: 112,459,813	M1K	probably null	Het
Cdc42bpa	A	G	1: 180,065,063	D264G	probably damaging	Het
Cic	A	G	7: 25,286,981	D1276G	probably damaging	Het
Col2a1	A	G	15: 97,990,907		probably benign	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Csn3	C	A	5: 87,930,023	N129K	possibly damaging	Het
Diaph1	C	A	18: 37,845,484	G1209W	probably damaging	Het
Dsg2	A	G	18: 20,602,117	T1051A	probably damaging	Het
Gm1965	A	T	6: 89,145,425		noncoding transcript	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Gsto1	T	C	19: 47,859,532		probably null	Het
Il15ra	G	T	2: 11,730,647		probably null	Het
Ipo8	A	T	6: 148,806,344		probably null	Het
Lsm14a	T	A	7: 34,353,779	I283F	probably damaging	Het
Mael	T	C	1: 166,238,566	D34G	probably damaging	Het
March6	A	T	15: 31,509,826		probably benign	Het
Mtmr10	C	A	7: 64,326,685	A410D	possibly damaging	Het
Myh9	T	C	15: 77,773,347	E1066G	possibly damaging	Het
Nim1k	A	G	13: 119,712,099	S420P	probably benign	Het
Nlrp4c	T	A	7: 6,065,628	V176E	probably damaging	Het
Ogfod1	A	T	8: 94,057,752	K313*	probably null	Het
Olfr1434	T	G	19: 12,283,086	F13V	probably damaging	Het
Osbpl10	C	A	9: 115,207,587	P253Q	probably benign	Het
Otof	A	T	5: 30,385,266	M661K	probably benign	Het
Rbms2	C	T	10: 128,143,443	R139Q	probably damaging	Het
Rimbp2	G	A	5: 128,789,731	T508I	probably benign	Het
Ros1	A	T	10: 52,161,895	C393*	probably null	Het
Rps17	T	A	7: 81,344,924	T30S	probably benign	Het
Rps3	T	C	7: 99,479,419	K197R	probably benign	Het
Samd11	G	A	4: 156,250,495	L109F	probably damaging	Het
Smarca2	T	G	19: 26,668,890		probably benign	Het
Sprr2g	C	A	3: 92,374,729	P30Q	unknown	Het
Spz1	G	A	13: 92,575,123	Q282*	probably null	Het
Syne3	A	G	12: 104,943,438	L713P	possibly damaging	Het
Tgm1	C	A	14: 55,712,595		probably benign	Het
Tomm22	T	C	15: 79,671,218	F55L	probably damaging	Het
Tph2	T	A	10: 115,174,058	Y199F	probably benign	Het
Vmn2r108	A	T	17: 20,462,670	F757L	probably benign	Het
Vmn2r69	T	A	7: 85,406,393	T846S	probably benign	Het
Was	G	T	X: 8,086,688	S271R	probably benign	Het
Zc3hav1	A	C	6: 38,332,162	M575R	probably benign	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCATTTTGGGACATGCAGGATG -3'
(R):5'- GATAAAGATACTGTTGCCCAGCC -3'

Sequencing Primer
(F):5'- CACCGAAGTGGCTTTAAGTACTG -3'
(R):5'- ATACTGTTGCCCAGCCCTTCC -3'

Posted On

2015-01-23