Incidental Mutation 'R3710:Was'
ID259576
Institutional Source Beutler Lab
Gene Symbol Was
Ensembl Gene ENSMUSG00000031165
Gene NameWiskott-Aldrich syndrome
SynonymsU42471, Wasp
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R3710 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location8081453-8090498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8086688 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 271 (S271R)
Ref Sequence ENSEMBL: ENSMUSP00000033505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033505]
Predicted Effect probably benign
Transcript: ENSMUST00000033505
AA Change: S271R

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033505
Gene: ENSMUSG00000031165
AA Change: S271R

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
WH1 41 147 5.3e-42 SMART
low complexity region 174 200 N/A INTRINSIC
low complexity region 227 237 N/A INTRINSIC
PBD 240 276 2.71e-10 SMART
low complexity region 314 321 N/A INTRINSIC
WH2 448 465 6.55e-5 SMART
SCOP:d1ej5a_ 478 510 4e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157586
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant females and hemizygous mutant males exhibit reduced numbers of peripheral blood lymphocytes and platelets, but increased numbers of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Was
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Was APN X 8087816 missense probably damaging 1.00
IGL02100:Was APN X 8090315 missense possibly damaging 0.54
R3709:Was UTSW X 8086688 missense probably benign 0.05
R6818:Was UTSW X 8086211 small deletion probably benign
R7601:Was UTSW X 8086211 small deletion probably benign
RF012:Was UTSW X 8086231 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGGTAAAATGACATTTATGTGTGC -3'
(R):5'- ATTGACCAAGGCTCAGAGC -3'

Sequencing Primer
(F):5'- ACTTTGTAGACCAGGCTGAC -3'
(R):5'- GCTCAGAGCCCATATCCAG -3'
Posted On2015-01-23