Mutagenetix > Incidental Mutations

Incidental Mutation 'R0329:Myo9a'

25958

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

038538-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 59923677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 2368 (T2368S)

Ref Sequence

ENSEMBL: ENSMUSP00000119401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably damaging
Transcript: ENSMUST00000128341
AA Change: T2368S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: T2368S

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000135298
AA Change: T2439S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: T2439S

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000136740
AA Change: T2457S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: T2457S

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 95.0%
20x: 89.0%

Validation Efficiency

99% (107/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,883,631	I400F	probably benign	Het
4833423E24Rik	T	A	2: 85,518,551	R72S	probably benign	Het
4931409K22Rik	T	C	5: 24,545,785		probably null	Het
Abca13	A	T	11: 9,399,430	H3668L	probably damaging	Het
Acvr1c	T	C	2: 58,284,838	T313A	probably damaging	Het
Adam28	T	C	14: 68,617,739	K651R	probably damaging	Het
Adamtsl3	A	T	7: 82,521,990	D417V	probably damaging	Het
Adgrf4	A	T	17: 42,667,313	C380S	probably damaging	Het
AI597479	T	G	1: 43,111,117	L129R	probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Anxa7	A	C	14: 20,469,498		probably null	Het
Arhgap22	A	G	14: 33,369,417	R650G	possibly damaging	Het
Atp8a1	T	A	5: 67,812,073		probably benign	Het
Bcr	C	T	10: 75,181,634	T1209I	possibly damaging	Het
Bmpr1a	C	T	14: 34,429,777	S185N	probably benign	Het
Calcoco1	A	T	15: 102,715,763	M246K	probably benign	Het
Casp12	T	A	9: 5,345,534		probably benign	Het
Ccno	T	A	13: 112,989,996	L333Q	probably damaging	Het
Cdhr2	T	A	13: 54,734,801		probably benign	Het
Cftr	T	A	6: 18,226,097	M318K	probably null	Het
Ckmt2	T	A	13: 91,863,203	D96V	possibly damaging	Het
Cnnm1	C	T	19: 43,441,910	P489L	probably damaging	Het
Cntnap1	A	T	11: 101,188,309	D1175V	probably damaging	Het
Cpne5	A	T	17: 29,211,660	L92H	probably damaging	Het
Crcp	C	A	5: 130,042,242	Q61K	possibly damaging	Het
Dcaf8	T	A	1: 172,187,411	D414E	probably benign	Het
Ddx28	T	C	8: 106,010,245	T394A	probably benign	Het
Ddx55	T	C	5: 124,559,147	F191L	probably benign	Het
Dnaaf1	T	C	8: 119,596,017		probably benign	Het
Dnaaf2	C	A	12: 69,197,744	R181L	probably damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elf5	A	G	2: 103,430,420		probably benign	Het
Emcn	T	A	3: 137,416,814		probably benign	Het
Erbb4	T	C	1: 68,298,280		probably benign	Het
Erbin	C	A	13: 103,868,865	C114F	probably damaging	Het
Etfdh	T	C	3: 79,609,844	I353V	probably benign	Het
Fam172a	T	A	13: 77,761,951		probably benign	Het
Fbxl12	C	T	9: 20,638,480	G316D	probably damaging	Het
Gbf1	G	A	19: 46,272,270		probably null	Het
Gbp2b	T	G	3: 142,608,176	S406A	probably benign	Het
Gli3	T	G	13: 15,723,558	L741R	probably damaging	Het
Gmip	G	T	8: 69,810,818	S70I	probably benign	Het
Gnptab	T	C	10: 88,440,309	S1153P	probably damaging	Het
Gp1ba	A	G	11: 70,640,409		probably benign	Het
Gramd1a	T	C	7: 31,138,254	D360G	possibly damaging	Het
Hectd4	T	C	5: 121,259,864	I285T	probably benign	Het
Hrh4	A	G	18: 13,007,245		probably benign	Het
Hsp90b1	T	C	10: 86,694,155	E226G	probably damaging	Het
Hspa13	A	T	16: 75,765,130	D60E	probably damaging	Het
Htt	T	A	5: 34,817,134		probably benign	Het
Ispd	C	T	12: 36,381,838	A22V	possibly damaging	Het
Kif14	G	C	1: 136,496,026		probably benign	Het
Kit	T	G	5: 75,652,829	V888G	probably damaging	Het
Lpin3	T	C	2: 160,905,305	V827A	probably benign	Het
Lrriq4	T	C	3: 30,655,724	S406P	probably benign	Het
Man2c1	T	C	9: 57,141,183	V777A	probably benign	Het
Mcm8	A	G	2: 132,819,994	K83E	possibly damaging	Het
Mep1a	A	G	17: 43,497,898		probably null	Het
Mtor	T	A	4: 148,484,380	V1119E	probably benign	Het
Mybpc2	C	T	7: 44,509,029	A710T	possibly damaging	Het
Nbeal1	A	G	1: 60,268,063	Y1684C	probably damaging	Het
Npm3	A	G	19: 45,749,526	F11L	probably benign	Het
Nutf2	T	A	8: 105,876,363	S37T	probably damaging	Het
Obscn	T	A	11: 59,040,441	I5790F	probably damaging	Het
Obscn	A	T	11: 59,052,506	D4833E	probably damaging	Het
Olfr1015	T	A	2: 85,785,803	C97*	probably null	Het
Olfr123	A	T	17: 37,795,989	M182L	probably benign	Het
Olfr39	T	A	9: 20,285,857	S61T	possibly damaging	Het
Olfr955	T	C	9: 39,470,556	T57A	possibly damaging	Het
Pcdhb1	A	G	18: 37,267,024	D676G	possibly damaging	Het
Pcif1	G	T	2: 164,889,444	R466L	probably damaging	Het
Pdk1	T	C	2: 71,895,674		probably benign	Het
Phxr2	T	C	10: 99,126,117		probably benign	Het
Pidd1	A	T	7: 141,439,561		probably benign	Het
Plec	A	G	15: 76,191,418		probably null	Het
Polr1a	T	A	6: 71,966,416	C1212S	possibly damaging	Het
Pot1a	A	G	6: 25,778,831		probably benign	Het
Prdm5	T	C	6: 65,862,903		probably benign	Het
Primpol	A	T	8: 46,610,461	N53K	probably damaging	Het
Pyroxd1	A	G	6: 142,361,976	I491V	probably benign	Het
Serpinb3b	G	T	1: 107,159,703	N25K	probably damaging	Het
Slc9b1	C	T	3: 135,373,235	R218*	probably null	Het
Ssbp2	T	A	13: 91,680,579		probably null	Het
Stat4	A	G	1: 52,090,870		probably benign	Het
Steap4	T	C	5: 7,975,829	V130A	possibly damaging	Het
Stoml2	A	G	4: 43,030,238		probably null	Het
Syne2	G	T	12: 75,966,953	G2974C	probably benign	Het
Tfdp2	T	G	9: 96,306,893	F200V	probably damaging	Het
Tgm4	T	C	9: 123,048,557		probably null	Het
Tie1	C	A	4: 118,484,727	R175L	probably benign	Het
Tmem145	A	G	7: 25,308,674		probably benign	Het
Tsacc	A	G	3: 88,282,862	S94P	possibly damaging	Het
Tshz3	T	A	7: 36,770,033	D482E	probably benign	Het
Tspan33	T	C	6: 29,711,092		probably null	Het
Ugt2b35	A	G	5: 87,003,405	K290R	probably null	Het
Unc80	T	C	1: 66,674,087	L2788P	possibly damaging	Het
Usp10	T	A	8: 119,936,557	C39*	probably null	Het
Utp20	T	A	10: 88,817,979	T260S	probably benign	Het
Vmn2r118	G	T	17: 55,610,717	T265K	probably damaging	Het
Vmn2r7	C	A	3: 64,691,018	C797F	probably damaging	Het
Vmn2r98	A	C	17: 19,066,347	H369P	probably benign	Het
Vps39	A	T	2: 120,338,787	Y245N	possibly damaging	Het
Wdr27	A	G	17: 14,934,459		probably benign	Het
Ythdc2	A	G	18: 44,865,060		probably benign	Het
Zcwpw2	C	A	9: 118,014,055		noncoding transcript	Het
Zdhhc1	C	A	8: 105,483,543	A81S	probably benign	Het
Zfp729a	G	T	13: 67,620,354	H585Q	probably damaging	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6194:Myo9a	UTSW	9	59869750	missense	probably benign	0.00
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCTTTCCTGCTTTTCATCATCACC -3'
(R):5'- GTCTACCTATGCAACATCATGTAATGAAGCTA -3'

Sequencing Primer
(F):5'- CATGGTGGGACAGTAAGAGATG -3'
(R):5'- catacacacacacacacacac -3'

Posted On

2013-04-16