Incidental Mutation 'R3711:Olfr1132'
ID259590
Institutional Source Beutler Lab
Gene Symbol Olfr1132
Ensembl Gene ENSMUSG00000068818
Gene Nameolfactory receptor 1132
SynonymsMOR177-1, GA_x6K02T2Q125-49140947-49140021
MMRRC Submission 040704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3711 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87632583-87637535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87635681 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000149683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090711] [ENSMUST00000216082]
Predicted Effect probably benign
Transcript: ENSMUST00000090711
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088213
Gene: ENSMUSG00000068818
AA Change: D22G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-45 PFAM
Pfam:7tm_1 41 290 4.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118805
Predicted Effect probably benign
Transcript: ENSMUST00000216082
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,946,255 V1138A possibly damaging Het
Adgrv1 A T 13: 81,419,475 I5193K probably benign Het
Adnp A T 2: 168,184,823 I184N probably damaging Het
Ahnak T G 19: 9,007,898 V2182G probably benign Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Aspm G A 1: 139,458,100 G494D probably benign Het
Atic T A 1: 71,578,579 S563T probably benign Het
Bahcc1 A T 11: 120,275,097 I1060F probably benign Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Dnm2 C A 9: 21,506,373 probably benign Het
Exo1 A G 1: 175,893,829 T345A probably benign Het
Fbf1 T C 11: 116,161,473 H53R possibly damaging Het
Fbf1 A G 11: 116,163,353 I29T probably damaging Het
Gm14399 G A 2: 175,131,510 R151* probably null Het
Gsdma T A 11: 98,666,219 Y53* probably null Het
Hid1 A T 11: 115,358,775 L208Q probably damaging Het
Kif4-ps A G 12: 101,146,053 E147G probably damaging Het
Kif7 A T 7: 79,710,892 V245D probably benign Het
Klhdc4 A G 8: 121,798,055 V378A probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mast3 C A 8: 70,779,607 R1242L probably benign Het
Mettl7a3 A T 15: 100,335,080 M51L probably benign Het
Mon1b T C 8: 113,639,147 M369T possibly damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Narf G T 11: 121,246,938 E224* probably null Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nmnat3 T A 9: 98,410,223 Y108N probably damaging Het
Npr2 A T 4: 43,643,378 Y534F probably benign Het
Obox5 A T 7: 15,758,788 M223L probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr365 A G 2: 37,201,273 T11A probably benign Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Optc A T 1: 133,905,081 S94T probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Stab2 A G 10: 86,866,708 L423P probably damaging Het
Sun5 A G 2: 153,867,548 V74A probably benign Het
Tanc2 A G 11: 105,798,690 Y226C probably damaging Het
Tlr6 T C 5: 64,953,809 D585G possibly damaging Het
Tnrc6c A G 11: 117,723,124 T863A probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Ythdc2 C T 18: 44,833,173 L159F probably damaging Het
Zc3h6 A G 2: 129,017,331 N1094S probably benign Het
Zdbf2 T C 1: 63,308,671 S2070P possibly damaging Het
Zfp648 T A 1: 154,204,558 S154R probably benign Het
Zfp748 A G 13: 67,540,796 C782R probably damaging Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Olfr1132
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Olfr1132 APN 2 87635384 missense probably damaging 1.00
IGL01780:Olfr1132 APN 2 87635080 missense possibly damaging 0.56
R1235:Olfr1132 UTSW 2 87634815 splice site probably null
R1471:Olfr1132 UTSW 2 87635670 missense probably benign
R2106:Olfr1132 UTSW 2 87635159 missense probably benign 0.22
R4024:Olfr1132 UTSW 2 87635155 missense probably damaging 0.97
R4522:Olfr1132 UTSW 2 87635151 missense probably benign
R6531:Olfr1132 UTSW 2 87635529 missense probably damaging 1.00
R7768:Olfr1132 UTSW 2 87635313 missense probably benign
R8036:Olfr1132 UTSW 2 87635503 missense probably benign 0.36
R8158:Olfr1132 UTSW 2 87634889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCCAATTGCTGTGGAATAG -3'
(R):5'- CAAGAACACCTTCTACATTTCAGAG -3'

Sequencing Primer
(F):5'- TGCTGTGGAATAGCAGAGGTCAC -3'
(R):5'- GTCAGATAAATTTTTGAAG -3'
Posted On2015-01-23