Incidental Mutation 'R3711:Zc3h6'
ID259594
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
MMRRC Submission 040704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R3711 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129017331 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1094 (N1094S)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
Predicted Effect probably benign
Transcript: ENSMUST00000110320
AA Change: N1094S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: N1094S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135186
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,946,255 V1138A possibly damaging Het
Adgrv1 A T 13: 81,419,475 I5193K probably benign Het
Adnp A T 2: 168,184,823 I184N probably damaging Het
Ahnak T G 19: 9,007,898 V2182G probably benign Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Aspm G A 1: 139,458,100 G494D probably benign Het
Atic T A 1: 71,578,579 S563T probably benign Het
Bahcc1 A T 11: 120,275,097 I1060F probably benign Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Dnm2 C A 9: 21,506,373 probably benign Het
Exo1 A G 1: 175,893,829 T345A probably benign Het
Fbf1 A G 11: 116,163,353 I29T probably damaging Het
Fbf1 T C 11: 116,161,473 H53R possibly damaging Het
Gm14399 G A 2: 175,131,510 R151* probably null Het
Gsdma T A 11: 98,666,219 Y53* probably null Het
Hid1 A T 11: 115,358,775 L208Q probably damaging Het
Kif4-ps A G 12: 101,146,053 E147G probably damaging Het
Kif7 A T 7: 79,710,892 V245D probably benign Het
Klhdc4 A G 8: 121,798,055 V378A probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mast3 C A 8: 70,779,607 R1242L probably benign Het
Mettl7a3 A T 15: 100,335,080 M51L probably benign Het
Mon1b T C 8: 113,639,147 M369T possibly damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Narf G T 11: 121,246,938 E224* probably null Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nmnat3 T A 9: 98,410,223 Y108N probably damaging Het
Npr2 A T 4: 43,643,378 Y534F probably benign Het
Obox5 A T 7: 15,758,788 M223L probably benign Het
Olfr1132 T C 2: 87,635,681 D22G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr365 A G 2: 37,201,273 T11A probably benign Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Optc A T 1: 133,905,081 S94T probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Stab2 A G 10: 86,866,708 L423P probably damaging Het
Sun5 A G 2: 153,867,548 V74A probably benign Het
Tanc2 A G 11: 105,798,690 Y226C probably damaging Het
Tlr6 T C 5: 64,953,809 D585G possibly damaging Het
Tnrc6c A G 11: 117,723,124 T863A probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Ythdc2 C T 18: 44,833,173 L159F probably damaging Het
Zdbf2 T C 1: 63,308,671 S2070P possibly damaging Het
Zfp648 T A 1: 154,204,558 S154R probably benign Het
Zfp748 A G 13: 67,540,796 C782R probably damaging Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCTCTTCAGAAGGCCTCC -3'
(R):5'- AAACGGTGATGCAGTTGGATC -3'

Sequencing Primer
(F):5'- ACTTCAAGTTCAGTTCTTAGTGGC -3'
(R):5'- GATGCAGTTGGATCAAACGTC -3'
Posted On2015-01-23