Mutagenetix > Incidental Mutation

Incidental Mutation 'R3711:Mast3'

259607

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

040704-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3711 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 70779607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1242 (R1242L)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably benign
Transcript: ENSMUST00000154685

SMART Domains

Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
PDB:2XS6\|A	43	84	3e-11	PDB
SCOP:d1pbwa_	47	79	6e-9	SMART
Blast:RhoGAP	58	84	4e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: R1258L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: R1258L

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: R1242L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.1025

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (51/52)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,946,255	V1138A	possibly damaging	Het
Adgrv1	A	T	13: 81,419,475	I5193K	probably benign	Het
Adnp	A	T	2: 168,184,823	I184N	probably damaging	Het
Ahnak	T	G	19: 9,007,898	V2182G	probably benign	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Aspm	G	A	1: 139,458,100	G494D	probably benign	Het
Atic	T	A	1: 71,578,579	S563T	probably benign	Het
Bahcc1	A	T	11: 120,275,097	I1060F	probably benign	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Dnm2	C	A	9: 21,506,373		probably benign	Het
Exo1	A	G	1: 175,893,829	T345A	probably benign	Het
Fbf1	T	C	11: 116,161,473	H53R	possibly damaging	Het
Fbf1	A	G	11: 116,163,353	I29T	probably damaging	Het
Gm14399	G	A	2: 175,131,510	R151*	probably null	Het
Gsdma	T	A	11: 98,666,219	Y53*	probably null	Het
Hid1	A	T	11: 115,358,775	L208Q	probably damaging	Het
Kif4-ps	A	G	12: 101,146,053	E147G	probably damaging	Het
Kif7	A	T	7: 79,710,892	V245D	probably benign	Het
Klhdc4	A	G	8: 121,798,055	V378A	probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mettl7a3	A	T	15: 100,335,080	M51L	probably benign	Het
Mon1b	T	C	8: 113,639,147	M369T	possibly damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Narf	G	T	11: 121,246,938	E224*	probably null	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Nmnat3	T	A	9: 98,410,223	Y108N	probably damaging	Het
Npr2	A	T	4: 43,643,378	Y534F	probably benign	Het
Obox5	A	T	7: 15,758,788	M223L	probably benign	Het
Olfr1132	T	C	2: 87,635,681	D22G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr365	A	G	2: 37,201,273	T11A	probably benign	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Olfr776	A	T	10: 129,261,224	K88*	probably null	Het
Optc	A	T	1: 133,905,081	S94T	probably benign	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
Stab2	A	G	10: 86,866,708	L423P	probably damaging	Het
Sun5	A	G	2: 153,867,548	V74A	probably benign	Het
Tanc2	A	G	11: 105,798,690	Y226C	probably damaging	Het
Tlr6	T	C	5: 64,953,809	D585G	possibly damaging	Het
Tnrc6c	A	G	11: 117,723,124	T863A	probably benign	Het
Ush2a	G	A	1: 188,810,292	G3352S	probably benign	Het
Wt1	G	A	2: 105,163,428		probably benign	Het
Ythdc2	C	T	18: 44,833,173	L159F	probably damaging	Het
Zc3h6	A	G	2: 129,017,331	N1094S	probably benign	Het
Zdbf2	T	C	1: 63,308,671	S2070P	possibly damaging	Het
Zfp648	T	A	1: 154,204,558	S154R	probably benign	Het
Zfp748	A	G	13: 67,540,796	C782R	probably damaging	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCATAAGGAACTGCAGCC -3'
(R):5'- AAGCAGTATCCCTCCATCTCCG -3'

Sequencing Primer
(F):5'- CAGCCAGAGGTGGTCAGTCTTTC -3'
(R):5'- CCATCTCCGCTGGCCTG -3'

Posted On

2015-01-23