Incidental Mutation 'R3711:Dnm2'
ID259610
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Namedynamin 2
Synonymsb2b2159Clo, Dyn2
MMRRC Submission 040704-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3711 (G1)
Quality Score222
Status Validated
Chromosome9
Chromosomal Location21424908-21507759 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 21506373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034698] [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000173397] [ENSMUST00000214285] [ENSMUST00000214576]
Predicted Effect probably benign
Transcript: ENSMUST00000034698
SMART Domains Protein: ENSMUSP00000034698
Gene: ENSMUSG00000032180

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EMP24_GP25L 33 220 1.78e-54 SMART
Predicted Effect unknown
Transcript: ENSMUST00000072362
AA Change: R862S
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335
AA Change: R862S

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000091087
AA Change: R858S
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335
AA Change: R858S

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115404
AA Change: R862S
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335
AA Change: R862S

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165766
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172482
AA Change: R862S
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335
AA Change: R862S

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173299
Predicted Effect unknown
Transcript: ENSMUST00000173397
AA Change: R861S
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335
AA Change: R861S

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174050
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174243
Predicted Effect probably benign
Transcript: ENSMUST00000213167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213316
Predicted Effect probably benign
Transcript: ENSMUST00000214285
Predicted Effect probably benign
Transcript: ENSMUST00000214576
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,946,255 V1138A possibly damaging Het
Adgrv1 A T 13: 81,419,475 I5193K probably benign Het
Adnp A T 2: 168,184,823 I184N probably damaging Het
Ahnak T G 19: 9,007,898 V2182G probably benign Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Aspm G A 1: 139,458,100 G494D probably benign Het
Atic T A 1: 71,578,579 S563T probably benign Het
Bahcc1 A T 11: 120,275,097 I1060F probably benign Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Exo1 A G 1: 175,893,829 T345A probably benign Het
Fbf1 T C 11: 116,161,473 H53R possibly damaging Het
Fbf1 A G 11: 116,163,353 I29T probably damaging Het
Gm14399 G A 2: 175,131,510 R151* probably null Het
Gsdma T A 11: 98,666,219 Y53* probably null Het
Hid1 A T 11: 115,358,775 L208Q probably damaging Het
Kif4-ps A G 12: 101,146,053 E147G probably damaging Het
Kif7 A T 7: 79,710,892 V245D probably benign Het
Klhdc4 A G 8: 121,798,055 V378A probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mast3 C A 8: 70,779,607 R1242L probably benign Het
Mettl7a3 A T 15: 100,335,080 M51L probably benign Het
Mon1b T C 8: 113,639,147 M369T possibly damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Narf G T 11: 121,246,938 E224* probably null Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nmnat3 T A 9: 98,410,223 Y108N probably damaging Het
Npr2 A T 4: 43,643,378 Y534F probably benign Het
Obox5 A T 7: 15,758,788 M223L probably benign Het
Olfr1132 T C 2: 87,635,681 D22G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr365 A G 2: 37,201,273 T11A probably benign Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Optc A T 1: 133,905,081 S94T probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Stab2 A G 10: 86,866,708 L423P probably damaging Het
Sun5 A G 2: 153,867,548 V74A probably benign Het
Tanc2 A G 11: 105,798,690 Y226C probably damaging Het
Tlr6 T C 5: 64,953,809 D585G possibly damaging Het
Tnrc6c A G 11: 117,723,124 T863A probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Ythdc2 C T 18: 44,833,173 L159F probably damaging Het
Zc3h6 A G 2: 129,017,331 N1094S probably benign Het
Zdbf2 T C 1: 63,308,671 S2070P possibly damaging Het
Zfp648 T A 1: 154,204,558 S154R probably benign Het
Zfp748 A G 13: 67,540,796 C782R probably damaging Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21481376 missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21465619 missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21500353 missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21425249 missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21485708 missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21485724 splice site probably benign
IGL03392:Dnm2 APN 9 21474611 missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21500343 missense probably benign 0.27
R0743:Dnm2 UTSW 9 21500265 missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21505660 missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21504458 missense probably damaging 1.00
R1678:Dnm2 UTSW 9 21467532 missense possibly damaging 0.89
R1848:Dnm2 UTSW 9 21505681 missense possibly damaging 0.87
R2084:Dnm2 UTSW 9 21500371 critical splice donor site probably null
R2214:Dnm2 UTSW 9 21485723 critical splice donor site probably null
R2346:Dnm2 UTSW 9 21467556 missense probably damaging 1.00
R3796:Dnm2 UTSW 9 21505487 missense probably benign
R4017:Dnm2 UTSW 9 21494604 missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21491304 intron probably benign
R4583:Dnm2 UTSW 9 21504446 missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21504664 critical splice donor site probably null
R4735:Dnm2 UTSW 9 21474587 missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21474629 missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21474679 splice site probably null
R4836:Dnm2 UTSW 9 21491330 intron probably benign
R4937:Dnm2 UTSW 9 21481337 missense probably benign 0.00
R4948:Dnm2 UTSW 9 21504533 missense possibly damaging 0.90
R5059:Dnm2 UTSW 9 21504578 missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21478907 missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21505627 missense probably benign 0.05
R5613:Dnm2 UTSW 9 21472667 missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21467669 missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21500275 missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21505646 missense probably benign 0.32
R6826:Dnm2 UTSW 9 21504471 nonsense probably null
R6855:Dnm2 UTSW 9 21476585 missense probably damaging 1.00
R7121:Dnm2 UTSW 9 21474566 missense probably benign 0.31
R7307:Dnm2 UTSW 9 21485687 missense probably damaging 1.00
R7318:Dnm2 UTSW 9 21505567 missense possibly damaging 0.46
R7467:Dnm2 UTSW 9 21481376 missense probably damaging 1.00
R7619:Dnm2 UTSW 9 21505634 missense probably benign 0.00
R7673:Dnm2 UTSW 9 21481421 critical splice donor site probably null
R8474:Dnm2 UTSW 9 21465720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCAAACTAGTGACATGG -3'
(R):5'- CTTCATTGTCATGTCCACTAGGG -3'

Sequencing Primer
(F):5'- GGAAAGTATCTGGACTTGACATAGTC -3'
(R):5'- TCATGTCCACTAGGGCGAGG -3'
Posted On2015-01-23