Incidental Mutation 'R3711:Mta3'
ID259630
Institutional Source Beutler Lab
Gene Symbol Mta3
Ensembl Gene ENSMUSG00000055817
Gene Namemetastasis associated 3
Synonyms1110002J22Rik
MMRRC Submission 040704-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.459) question?
Stock #R3711 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83706163-83821516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83762988 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 193 (I193V)
Ref Sequence ENSEMBL: ENSMUSP00000107971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067826] [ENSMUST00000112349] [ENSMUST00000112350] [ENSMUST00000112352] [ENSMUST00000176816] [ENSMUST00000177069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067826
AA Change: I192V

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068931
Gene: ENSMUSG00000055817
AA Change: I192V

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 203 3.49e-16 SMART
SANT 266 315 7.94e-8 SMART
ZnF_GATA 371 425 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112349
AA Change: I193V

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107968
Gene: ENSMUSG00000055817
AA Change: I193V

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 373 427 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112350
AA Change: I193V

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107969
Gene: ENSMUSG00000055817
AA Change: I193V

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 372 426 8.33e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112352
AA Change: I193V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107971
Gene: ENSMUSG00000055817
AA Change: I193V

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 372 426 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176816
AA Change: I41V

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135752
Gene: ENSMUSG00000055817
AA Change: I41V

DomainStartEndE-ValueType
ELM2 1 52 3.23e-11 SMART
SANT 115 164 7.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177069
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,946,255 V1138A possibly damaging Het
Adgrv1 A T 13: 81,419,475 I5193K probably benign Het
Adnp A T 2: 168,184,823 I184N probably damaging Het
Ahnak T G 19: 9,007,898 V2182G probably benign Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Aspm G A 1: 139,458,100 G494D probably benign Het
Atic T A 1: 71,578,579 S563T probably benign Het
Bahcc1 A T 11: 120,275,097 I1060F probably benign Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Dnm2 C A 9: 21,506,373 probably benign Het
Exo1 A G 1: 175,893,829 T345A probably benign Het
Fbf1 T C 11: 116,161,473 H53R possibly damaging Het
Fbf1 A G 11: 116,163,353 I29T probably damaging Het
Gm14399 G A 2: 175,131,510 R151* probably null Het
Gsdma T A 11: 98,666,219 Y53* probably null Het
Hid1 A T 11: 115,358,775 L208Q probably damaging Het
Kif4-ps A G 12: 101,146,053 E147G probably damaging Het
Kif7 A T 7: 79,710,892 V245D probably benign Het
Klhdc4 A G 8: 121,798,055 V378A probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mast3 C A 8: 70,779,607 R1242L probably benign Het
Mettl7a3 A T 15: 100,335,080 M51L probably benign Het
Mon1b T C 8: 113,639,147 M369T possibly damaging Het
Narf G T 11: 121,246,938 E224* probably null Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nmnat3 T A 9: 98,410,223 Y108N probably damaging Het
Npr2 A T 4: 43,643,378 Y534F probably benign Het
Obox5 A T 7: 15,758,788 M223L probably benign Het
Olfr1132 T C 2: 87,635,681 D22G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr365 A G 2: 37,201,273 T11A probably benign Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Optc A T 1: 133,905,081 S94T probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Stab2 A G 10: 86,866,708 L423P probably damaging Het
Sun5 A G 2: 153,867,548 V74A probably benign Het
Tanc2 A G 11: 105,798,690 Y226C probably damaging Het
Tlr6 T C 5: 64,953,809 D585G possibly damaging Het
Tnrc6c A G 11: 117,723,124 T863A probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Ythdc2 C T 18: 44,833,173 L159F probably damaging Het
Zc3h6 A G 2: 129,017,331 N1094S probably benign Het
Zdbf2 T C 1: 63,308,671 S2070P possibly damaging Het
Zfp648 T A 1: 154,204,558 S154R probably benign Het
Zfp748 A G 13: 67,540,796 C782R probably damaging Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Mta3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00467:Mta3 APN 17 83755684 splice site probably benign
IGL00475:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00539:Mta3 APN 17 83762983 missense probably benign 0.25
IGL01722:Mta3 APN 17 83755643 missense possibly damaging 0.95
IGL03355:Mta3 APN 17 83800045 splice site probably benign
container UTSW 17 83708446 missense probably damaging 1.00
R0440:Mta3 UTSW 17 83766587 missense probably damaging 1.00
R0630:Mta3 UTSW 17 83714627 missense probably damaging 0.98
R1848:Mta3 UTSW 17 83755551 splice site probably benign
R1870:Mta3 UTSW 17 83781968 missense probably damaging 0.98
R2358:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R2373:Mta3 UTSW 17 83784301 nonsense probably null
R2447:Mta3 UTSW 17 83804544 missense probably benign 0.03
R3712:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R4107:Mta3 UTSW 17 83762914 missense probably benign 0.00
R4771:Mta3 UTSW 17 83755674 missense probably damaging 0.98
R5259:Mta3 UTSW 17 83804574 missense probably damaging 1.00
R5980:Mta3 UTSW 17 83708405 missense probably damaging 1.00
R6175:Mta3 UTSW 17 83791793 missense probably benign
R6555:Mta3 UTSW 17 83708446 missense probably damaging 1.00
R6909:Mta3 UTSW 17 83766551 missense possibly damaging 0.92
R7170:Mta3 UTSW 17 83714662 missense probably damaging 1.00
R7350:Mta3 UTSW 17 83708441 missense probably damaging 1.00
R7597:Mta3 UTSW 17 83775582 missense probably benign 0.05
R7638:Mta3 UTSW 17 83800143 missense probably benign
R7747:Mta3 UTSW 17 83791736 nonsense probably null
R7894:Mta3 UTSW 17 83762934 missense probably benign 0.01
R8170:Mta3 UTSW 17 83791661 missense probably damaging 1.00
R8799:Mta3 UTSW 17 83788940 missense possibly damaging 0.93
R8944:Mta3 UTSW 17 83775717 missense probably damaging 1.00
Z1088:Mta3 UTSW 17 83762914 missense probably benign 0.00
Z1177:Mta3 UTSW 17 83781968 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATGTGTTACAGTGTCAATAACAACC -3'
(R):5'- TGAGGCATTAGCAGTGAGACAC -3'

Sequencing Primer
(F):5'- GTCAATAACAACCATATGCTACAGTG -3'
(R):5'- AATGCTGCTCTCACAGAGG -3'
Posted On2015-01-23