Mutagenetix > Incidental Mutation

Incidental Mutation 'R3711:Nedd4l'

259634

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

040704-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R3711 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 65209719 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 909 (V909I)

Ref Sequence

ENSEMBL: ENSMUSP00000132838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080418
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: V788I

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163516
AA Change: V909I

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: V909I

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224347
AA Change: V768I

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224663

Predicted Effect

probably benign
Transcript: ENSMUST00000226058
AA Change: V788I

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.1459

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,946,255	V1138A	possibly damaging	Het
Adgrv1	A	T	13: 81,419,475	I5193K	probably benign	Het
Adnp	A	T	2: 168,184,823	I184N	probably damaging	Het
Ahnak	T	G	19: 9,007,898	V2182G	probably benign	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Aspm	G	A	1: 139,458,100	G494D	probably benign	Het
Atic	T	A	1: 71,578,579	S563T	probably benign	Het
Bahcc1	A	T	11: 120,275,097	I1060F	probably benign	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Dnm2	C	A	9: 21,506,373		probably benign	Het
Exo1	A	G	1: 175,893,829	T345A	probably benign	Het
Fbf1	T	C	11: 116,161,473	H53R	possibly damaging	Het
Fbf1	A	G	11: 116,163,353	I29T	probably damaging	Het
Gm14399	G	A	2: 175,131,510	R151*	probably null	Het
Gsdma	T	A	11: 98,666,219	Y53*	probably null	Het
Hid1	A	T	11: 115,358,775	L208Q	probably damaging	Het
Kif4-ps	A	G	12: 101,146,053	E147G	probably damaging	Het
Kif7	A	T	7: 79,710,892	V245D	probably benign	Het
Klhdc4	A	G	8: 121,798,055	V378A	probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mast3	C	A	8: 70,779,607	R1242L	probably benign	Het
Mettl7a3	A	T	15: 100,335,080	M51L	probably benign	Het
Mon1b	T	C	8: 113,639,147	M369T	possibly damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Narf	G	T	11: 121,246,938	E224*	probably null	Het
Nmnat3	T	A	9: 98,410,223	Y108N	probably damaging	Het
Npr2	A	T	4: 43,643,378	Y534F	probably benign	Het
Obox5	A	T	7: 15,758,788	M223L	probably benign	Het
Olfr1132	T	C	2: 87,635,681	D22G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr365	A	G	2: 37,201,273	T11A	probably benign	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Olfr776	A	T	10: 129,261,224	K88*	probably null	Het
Optc	A	T	1: 133,905,081	S94T	probably benign	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
Stab2	A	G	10: 86,866,708	L423P	probably damaging	Het
Sun5	A	G	2: 153,867,548	V74A	probably benign	Het
Tanc2	A	G	11: 105,798,690	Y226C	probably damaging	Het
Tlr6	T	C	5: 64,953,809	D585G	possibly damaging	Het
Tnrc6c	A	G	11: 117,723,124	T863A	probably benign	Het
Ush2a	G	A	1: 188,810,292	G3352S	probably benign	Het
Wt1	G	A	2: 105,163,428		probably benign	Het
Ythdc2	C	T	18: 44,833,173	L159F	probably damaging	Het
Zc3h6	A	G	2: 129,017,331	N1094S	probably benign	Het
Zdbf2	T	C	1: 63,308,671	S2070P	possibly damaging	Het
Zfp648	T	A	1: 154,204,558	S154R	probably benign	Het
Zfp748	A	G	13: 67,540,796	C782R	probably damaging	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1643:Nedd4l	UTSW	18	65198641	missense	probably damaging	1.00
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2070:Nedd4l	UTSW	18	65212820	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2154:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5106:Nedd4l	UTSW	18	65193305	missense	probably damaging	1.00
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6465:Nedd4l	UTSW	18	65155264	missense	probably benign	0.06
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7065:Nedd4l	UTSW	18	65195969	missense	probably benign	0.04
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7496:Nedd4l	UTSW	18	65080018	missense	possibly damaging	0.94
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCGACTGTTATAAAGGGTGAGAC -3'
(R):5'- CAGTTCCTGTGGGTTGAAGC -3'

Sequencing Primer
(F):5'- AGACAATGCCGGTCTTGG -3'
(R):5'- GGTTGAAGCCCTCTGTTCTGC -3'

Posted On

2015-01-23