Incidental Mutation 'R3712:Pard3b'
ID259638
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Namepar-3 family cell polarity regulator beta
SynonymsPAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L
MMRRC Submission 040705-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3712 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location61638824-62642284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62343978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 744 (S744P)
Ref Sequence ENSEMBL: ENSMUSP00000092510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
Predicted Effect probably damaging
Transcript: ENSMUST00000046673
AA Change: S682P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: S682P

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075374
AA Change: S744P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: S744P

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094906
AA Change: S744P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: S744P

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Meta Mutation Damage Score 0.1685 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik C A 16: 88,627,523 V27F unknown Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Alx4 G A 2: 93,642,789 G44D possibly damaging Het
Arhgap31 T A 16: 38,602,533 E1057V possibly damaging Het
Arhgef26 A T 3: 62,423,629 D588V probably damaging Het
Bag2 T A 1: 33,746,916 E108D probably benign Het
Ccdc162 C T 10: 41,587,379 V183I probably benign Het
Ccdc58 T C 16: 36,081,405 probably null Het
Ccdc83 A G 7: 90,236,355 probably benign Het
Ccnyl1 G A 1: 64,714,668 E137K probably damaging Het
Celsr2 T C 3: 108,400,839 T1849A probably benign Het
Cep192 C A 18: 67,820,329 D472E probably benign Het
Cep57l1 A G 10: 41,743,114 Y86H probably damaging Het
Cep95 G T 11: 106,811,286 E370* probably null Het
Cldn10 A G 14: 118,855,110 T41A probably damaging Het
Clptm1l T A 13: 73,616,038 Y426N probably benign Het
Eps15 T C 4: 109,309,177 V89A probably damaging Het
Fam53b A G 7: 132,759,925 S125P probably damaging Het
Fam69b T C 2: 26,632,638 L33S possibly damaging Het
Fbxo44 A T 4: 148,156,004 W256R probably benign Het
Gnl2 T C 4: 125,046,274 V313A probably damaging Het
Hyal4 A G 6: 24,756,514 R244G probably damaging Het
Irf6 G T 1: 193,162,623 W134L probably benign Het
Kcnu1 A G 8: 25,881,420 T286A probably damaging Het
Lpcat2 T C 8: 92,918,170 V529A possibly damaging Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp8 G T 4: 107,848,302 R209L probably benign Het
Mgll T C 6: 88,764,588 probably benign Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr411 A T 11: 74,347,197 I129N probably damaging Het
Olfr490 A T 7: 108,286,456 Y223* probably null Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Orc1 T C 4: 108,604,021 V526A probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pdcd11 T A 19: 47,127,245 probably benign Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Pigt A G 2: 164,501,645 D347G probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Rpl7a-ps10 A G 9: 97,179,873 E232G probably damaging Het
Rprd2 A G 3: 95,764,560 L1177P probably damaging Het
Rrn3 T A 16: 13,784,095 L71* probably null Het
Sbspon A G 1: 15,892,445 C70R probably damaging Het
Smtn A T 11: 3,532,865 probably null Het
Son A G 16: 91,656,726 D787G probably damaging Het
Sphkap C T 1: 83,277,112 S972N probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Srp14 A C 2: 118,478,959 L58V probably null Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trdn T C 10: 33,157,166 I129T probably benign Het
Trpv3 A G 11: 73,278,954 K117R probably benign Het
Ubqlnl A T 7: 104,149,138 I384N probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r59 A T 7: 5,454,638 I41K probably damaging Het
Vmn2r125 T A 4: 156,350,124 Y68* probably null Het
Zpld1 A T 16: 55,226,436 L390* probably null Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62161198 missense probably damaging 0.99
IGL01363:Pard3b APN 1 62637640 missense probably damaging 1.00
IGL01509:Pard3b APN 1 62161248 missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62637862 missense probably damaging 0.96
IGL01651:Pard3b APN 1 62479804 intron probably benign
IGL01670:Pard3b APN 1 62211648 missense probably damaging 1.00
IGL02156:Pard3b APN 1 61767950 missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62166382 missense probably damaging 1.00
IGL02450:Pard3b APN 1 62532676 missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62198771 splice site probably benign
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0060:Pard3b UTSW 1 61639315 missense probably damaging 0.97
R0157:Pard3b UTSW 1 62211633 missense probably damaging 0.96
R0333:Pard3b UTSW 1 62230212 missense probably benign 0.00
R0448:Pard3b UTSW 1 62166469 missense probably damaging 1.00
R0465:Pard3b UTSW 1 62211718 splice site probably benign
R0497:Pard3b UTSW 1 62440008 splice site probably null
R1264:Pard3b UTSW 1 62164157 missense probably damaging 1.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1482:Pard3b UTSW 1 62166367 missense probably damaging 1.00
R1554:Pard3b UTSW 1 62637894 missense probably damaging 0.97
R1836:Pard3b UTSW 1 62637604 missense probably benign 0.03
R2005:Pard3b UTSW 1 62144891 missense probably benign 0.12
R2220:Pard3b UTSW 1 62479683 nonsense probably null
R2435:Pard3b UTSW 1 62587738 missense probably damaging 1.00
R3015:Pard3b UTSW 1 62344878 missense probably damaging 1.00
R3688:Pard3b UTSW 1 62479569 missense probably benign
R3799:Pard3b UTSW 1 62161229 missense probably benign 0.06
R3942:Pard3b UTSW 1 62159452 missense probably damaging 1.00
R4683:Pard3b UTSW 1 62216516 missense probably benign
R4729:Pard3b UTSW 1 62211684 missense probably damaging 1.00
R4898:Pard3b UTSW 1 61768000 missense probably damaging 1.00
R4981:Pard3b UTSW 1 62344060 missense probably damaging 1.00
R5049:Pard3b UTSW 1 62161161 missense probably benign 0.01
R5223:Pard3b UTSW 1 62344113 missense probably damaging 1.00
R5476:Pard3b UTSW 1 62010406 missense probably benign 0.10
R5541:Pard3b UTSW 1 61639343 missense probably damaging 1.00
R5672:Pard3b UTSW 1 62010466 missense probably benign 0.11
R5714:Pard3b UTSW 1 62637916 missense probably null 0.99
R5722:Pard3b UTSW 1 62440001 splice site probably null
R5793:Pard3b UTSW 1 61767973 missense probably damaging 1.00
R5930:Pard3b UTSW 1 61768130 intron probably benign
R5950:Pard3b UTSW 1 62216531 missense probably benign 0.04
R5997:Pard3b UTSW 1 62076409 missense probably damaging 1.00
R6646:Pard3b UTSW 1 62161121 missense probably benign 0.32
R6720:Pard3b UTSW 1 62159470 missense probably damaging 0.99
R6809:Pard3b UTSW 1 62161181 missense probably damaging 1.00
R7148:Pard3b UTSW 1 62440032 missense probably benign 0.01
R7847:Pard3b UTSW 1 62343934 missense probably benign 0.00
R7879:Pard3b UTSW 1 62159511 missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62153989 missense probably damaging 1.00
R8125:Pard3b UTSW 1 61767984 missense probably damaging 1.00
R8329:Pard3b UTSW 1 62637798 missense probably benign 0.30
R8766:Pard3b UTSW 1 62159478 missense probably benign 0.35
R8833:Pard3b UTSW 1 62344999 missense probably benign 0.00
R8889:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8892:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8907:Pard3b UTSW 1 62344135 missense probably benign 0.39
R8909:Pard3b UTSW 1 62344135 missense probably benign 0.39
Z1176:Pard3b UTSW 1 62238892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCATCTAAAATCTTACCACAGCTG -3'
(R):5'- TGAGATGAAGAGCCCACTTAAG -3'

Sequencing Primer
(F):5'- TTTCAGAGATGGCAGCCTAC -3'
(R):5'- CCCACTTAAGGGGGCATATG -3'
Posted On2015-01-23