Mutagenetix > Incidental Mutations

Incidental Mutation 'R3712:Clptm1l'

259682

Institutional Source

Beutler Lab

Gene Symbol

Clptm1l

Ensembl Gene

ENSMUSG00000021610

Gene Name

CLPTM1-like

Synonyms

C130052I12Rik

MMRRC Submission

040705-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3712 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73604006-73620605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73616038 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 426 (Y426N)

Ref Sequence

ENSEMBL: ENSMUSP00000022102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022102]

AlphaFold

Q8BXA5

Predicted Effect

probably benign
Transcript: ENSMUST00000022102
AA Change: Y426N

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: Y426N

Domain	Start	End	E-Value	Type
Pfam:CLPTM1	10	423	3.2e-134	PFAM
transmembrane domain	428	450	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221130

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222343

Meta Mutation Damage Score

0.6879

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310079G19Rik	C	A	16: 88,627,523	V27F	unknown	Het
Akr1c20	T	C	13: 4,510,223	E152G	probably damaging	Het
Alx4	G	A	2: 93,642,789	G44D	possibly damaging	Het
Arhgap31	T	A	16: 38,602,533	E1057V	possibly damaging	Het
Arhgef26	A	T	3: 62,423,629	D588V	probably damaging	Het
Bag2	T	A	1: 33,746,916	E108D	probably benign	Het
Ccdc162	C	T	10: 41,587,379	V183I	probably benign	Het
Ccdc58	T	C	16: 36,081,405		probably null	Het
Ccdc83	A	G	7: 90,236,355		probably benign	Het
Ccnyl1	G	A	1: 64,714,668	E137K	probably damaging	Het
Celsr2	T	C	3: 108,400,839	T1849A	probably benign	Het
Cep192	C	A	18: 67,820,329	D472E	probably benign	Het
Cep57l1	A	G	10: 41,743,114	Y86H	probably damaging	Het
Cep95	G	T	11: 106,811,286	E370*	probably null	Het
Cldn10	A	G	14: 118,855,110	T41A	probably damaging	Het
Eps15	T	C	4: 109,309,177	V89A	probably damaging	Het
Fam53b	A	G	7: 132,759,925	S125P	probably damaging	Het
Fam69b	T	C	2: 26,632,638	L33S	possibly damaging	Het
Fbxo44	A	T	4: 148,156,004	W256R	probably benign	Het
Gnl2	T	C	4: 125,046,274	V313A	probably damaging	Het
Hyal4	A	G	6: 24,756,514	R244G	probably damaging	Het
Irf6	G	T	1: 193,162,623	W134L	probably benign	Het
Kcnu1	A	G	8: 25,881,420	T286A	probably damaging	Het
Lpcat2	T	C	8: 92,918,170	V529A	possibly damaging	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp8	G	T	4: 107,848,302	R209L	probably benign	Het
Mgll	T	C	6: 88,764,588		probably benign	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr411	A	T	11: 74,347,197	I129N	probably damaging	Het
Olfr490	A	T	7: 108,286,456	Y223*	probably null	Het
Olfr776	A	T	10: 129,261,224	K88*	probably null	Het
Orc1	T	C	4: 108,604,021	V526A	probably damaging	Het
Pard3b	T	C	1: 62,343,978	S744P	probably damaging	Het
Pcnx3	G	A	19: 5,683,339	Q155*	probably null	Het
Pcnx3	C	G	19: 5,683,340	L1F	probably null	Het
Pdcd11	T	A	19: 47,127,245		probably benign	Het
Pi4k2a	G	A	19: 42,090,692	R64Q	probably damaging	Het
Pigt	A	G	2: 164,501,645	D347G	probably benign	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Rpl7a-ps10	A	G	9: 97,179,873	E232G	probably damaging	Het
Rprd2	A	G	3: 95,764,560	L1177P	probably damaging	Het
Rrn3	T	A	16: 13,784,095	L71*	probably null	Het
Sbspon	A	G	1: 15,892,445	C70R	probably damaging	Het
Smtn	A	T	11: 3,532,865		probably null	Het
Son	A	G	16: 91,656,726	D787G	probably damaging	Het
Sphkap	C	T	1: 83,277,112	S972N	probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
Srp14	A	C	2: 118,478,959	L58V	probably null	Het
Sun2	A	G	15: 79,727,913	S522P	possibly damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Trdn	T	C	10: 33,157,166	I129T	probably benign	Het
Trpv3	A	G	11: 73,278,954	K117R	probably benign	Het
Ubqlnl	A	T	7: 104,149,138	I384N	probably benign	Het
Ush2a	G	A	1: 188,810,292	G3352S	probably benign	Het
Vmn1r59	A	T	7: 5,454,638	I41K	probably damaging	Het
Vmn2r125	T	A	4: 156,350,124	Y68*	probably null	Het
Zpld1	A	T	16: 55,226,436	L390*	probably null	Het

Other mutations in Clptm1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01672:Clptm1l	APN	13	73607873	splice site	probably null
IGL01963:Clptm1l	APN	13	73617569	splice site	probably benign
IGL02169:Clptm1l	APN	13	73611663	missense	probably damaging	0.96
IGL02554:Clptm1l	APN	13	73607760	missense	probably benign	0.07
IGL02596:Clptm1l	APN	13	73613666	missense	probably benign	0.02
IGL02720:Clptm1l	APN	13	73614602	splice site	probably benign
IGL03100:Clptm1l	APN	13	73612390	splice site	probably benign
P0023:Clptm1l	UTSW	13	73604952	missense	possibly damaging	0.67
R0308:Clptm1l	UTSW	13	73611667	missense	possibly damaging	0.67
R0725:Clptm1l	UTSW	13	73606343	missense	probably benign
R1572:Clptm1l	UTSW	13	73607747	missense	probably benign
R1589:Clptm1l	UTSW	13	73614673	critical splice donor site	probably null
R2062:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2064:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2065:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2067:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2068:Clptm1l	UTSW	13	73607723	nonsense	probably null
R3003:Clptm1l	UTSW	13	73617756	missense	possibly damaging	0.51
R3808:Clptm1l	UTSW	13	73612454	missense	probably benign	0.13
R3966:Clptm1l	UTSW	13	73615972	missense	probably damaging	1.00
R4615:Clptm1l	UTSW	13	73607738	nonsense	probably null
R4801:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4802:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4957:Clptm1l	UTSW	13	73611196	missense	possibly damaging	0.52
R4957:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R5864:Clptm1l	UTSW	13	73606284	missense	probably damaging	0.99
R6502:Clptm1l	UTSW	13	73617765	critical splice donor site	probably null
R6701:Clptm1l	UTSW	13	73608906	missense	probably benign	0.00
R6720:Clptm1l	UTSW	13	73618516	missense	probably damaging	1.00
R7782:Clptm1l	UTSW	13	73604320	missense	probably damaging	1.00
R8292:Clptm1l	UTSW	13	73617735	missense	probably damaging	0.96
R8329:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R9224:Clptm1l	UTSW	13	73604225	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCATGGCCATTAGACACAG -3'
(R):5'- ACAGCAGATTCTGGCCTGTATC -3'

Sequencing Primer
(F):5'- CCGAAATGTTATTGGGGTCTCACC -3'
(R):5'- ATCTGAGAAGAGTCCTGAGTTCC -3'

Posted On

2015-01-23